Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NKD2 cdna clone

NKD2 cDNA Clone

Gene Names
NKD2; Naked2
Synonyms
NKD2; NKD2 cDNA Clone; NKD2 cdna clone
Ordering
For Research Use Only!
Sequence
atggggaaactgcagtcgaagcacgccgccgccgcccgcaagcggagagagagcccggaaggggacagcttcgtggcgtccgcgtacgcgagcggccgcaaaggcgcggaggaagcggagcggcgcgcgcgggacaagcaggagctgcccaatggggaccccaaggaggggcctttccgggaggaccagtgtcccctacaggtggcactccccgctgagaaagctgagggccgcgagcacccgggacaactcctcagcgcagatgacggagagagggcagcaaaccgcgagggcccgcgaggaccgggcgggcagcgcctcaacattgacgcactccagtgcgatgtctcggtggaggaggacgaccgccaggagtggacgttcacgctctatgactttgacaactgcgggaaggtcaccagggaggacatgtccagcctcatgcacaccatctatgaggtcgtggatgcctcggtcaaccactcctcgggcagcagcaagaccctccgtgtgaagctaaccgtcagccctgagccctccagcaagaggaaggagggtcctcctgctggccaggaccgggagcccacccgttgcaggatggagggtgaactggcagaggagccaagggtggctgacaggaggttgtctgcacacgtcaggaggcccagtactgacccccagccctgctcggagcgggggccctactgcgtggacgagaacacggagcgcagaaaccactacctggacctcgccgggattgagaactacacgtccagattcggccctgggtctcagctgtgcgagaagagaagctccgctcccaggacacacagtggggacaaggctagaggagtcggcctttgcagggagctgtggagccaggcaggtcacccacagtggccaggccccttcccttcagggctggtggccgtctga
Sequence Length
936
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,314 Da
NCBI Official Full Name
Homo sapiens naked cuticle homolog 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
naked cuticle homolog 2
NCBI Official Symbol
NKD2
NCBI Official Synonym Symbols
Naked2
NCBI Protein Information
protein naked cuticle homolog 2
UniProt Protein Name
Protein naked cuticle homolog 2
Protein Family
UniProt Gene Name
NKD2
UniProt Synonym Gene Names
Naked-2; hNkd2
UniProt Entry Name
NKD2_HUMAN

NCBI Description

This gene encodes a member of a family of proteins that function as negative regulators of Wnt receptor signaling through interaction with Dishevelled family members. The encoded protein participates in the delivery of transforming growth factor alpha-containing vesicles to the cell membrane. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]

Uniprot Description

NKD2: Cell autonomous antagonist of the canonical Wnt signaling pathway. May activate a second Wnt signaling pathway that controls planar cell polarity. Required for processing of TGFA and for targeting of TGFA to the basolateral membrane of polarized epithelial cells. Interacts with DVL1, DVL2, DVL3 and PPP2R3A. Interacts with RNF25 and TGFA (via cytoplasmic domain). Expressed in kidney, lung, pancreas and spleen. Belongs to the NKD family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Cell development/differentiation; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 5p15.3

Cellular Component: basolateral plasma membrane; cytoplasmic vesicle; lateral plasma membrane

Molecular Function: growth factor binding; protein binding; ubiquitin protein ligase binding

Biological Process: Golgi vesicle fusion to target membrane; positive regulation of proteasomal ubiquitin-dependent protein catabolic process

Research Articles on NKD2

Similar Products

Product Notes

The NKD2 nkd2 (Catalog #AAA1277227) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaaac tgcagtcgaa gcacgccgcc gccgcccgca agcggagaga gagcccggaa ggggacagct tcgtggcgtc cgcgtacgcg agcggccgca aaggcgcgga ggaagcggag cggcgcgcgc gggacaagca ggagctgccc aatggggacc ccaaggaggg gcctttccgg gaggaccagt gtcccctaca ggtggcactc cccgctgaga aagctgaggg ccgcgagcac ccgggacaac tcctcagcgc agatgacgga gagagggcag caaaccgcga gggcccgcga ggaccgggcg ggcagcgcct caacattgac gcactccagt gcgatgtctc ggtggaggag gacgaccgcc aggagtggac gttcacgctc tatgactttg acaactgcgg gaaggtcacc agggaggaca tgtccagcct catgcacacc atctatgagg tcgtggatgc ctcggtcaac cactcctcgg gcagcagcaa gaccctccgt gtgaagctaa ccgtcagccc tgagccctcc agcaagagga aggagggtcc tcctgctggc caggaccggg agcccacccg ttgcaggatg gagggtgaac tggcagagga gccaagggtg gctgacagga ggttgtctgc acacgtcagg aggcccagta ctgaccccca gccctgctcg gagcgggggc cctactgcgt ggacgagaac acggagcgca gaaaccacta cctggacctc gccgggattg agaactacac gtccagattc ggccctgggt ctcagctgtg cgagaagaga agctccgctc ccaggacaca cagtggggac aaggctagag gagtcggcct ttgcagggag ctgtggagcc aggcaggtca cccacagtgg ccaggcccct tcccttcagg gctggtggcc gtctga. It is sometimes possible for the material contained within the vial of "NKD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.