Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NR3C1 cdna clone

NR3C1 cDNA Clone

Gene Names
NR3C1; GR; GCR; GRL; GCCR; GCRST
Synonyms
NR3C1; NR3C1 cDNA Clone; NR3C1 cdna clone
Ordering
For Research Use Only!
Sequence
atggactccaaagaatcattaactcctggtagagaagaaaaccccagcagtgtgcttgctcaggagaggggagatgtgatggacttctataaaaccctaagaggaggagctactgtgaaggtttctgcgtcttcaccctcactggctgtcgcttctcaatcagactccaagcagcgaagacttttggttgattttccaaaaggctcagtaagcaatgcgcagcagccagatctgtccaaagcagtttcactctcaatgggactgtatatgggagagacagaaacaaaagtgatgggaaatgacctgggattcccacagcagggccaaatcagcctttcctcgggggaaacagacttaaagcttttggaagaaagcattgcaaacctcaataggtcgaccagtgttccagagaaccccaagagttcagcatccactgctgtgtctgctgcccccacagagaaggagtttccaaaaactcactctgatgtatcttcagaacagcaacatttgaagggccagactggcaccaacggtggcaatgtgaaattgtataccacagaccaaagcacctttgacattttgcaggatttggagttttcttctgggtccccaggtaaagagacgaatgagagtccttggagatcagacctgttgatagatgaaaactgtttgctttctcctctggcgggagaagacgattcattccttttggaaggaaactcgaatgaggactgcaagcctctcattttaccggacactaaacccaaaattaaggataatggagatctggttttgtcaagccccagtaatgtaacactgccccaagtgaaaacagaaaaagaagatttcatcgaactctgcacccctggggtaattaagcaagagaaactgggcacagtttactgtcaggcaagctttcctggagcaaatataattggtaataaaatgtctgccatttctgttcatggtgtgagtacctctggaggacagatgtaccactatgacatgaatacagcatccctttctcaacagcaggatcagaagcctatttttaatgtcattccaccaattcccgttggttccgaaaattggaataggtgccaaggatctggagatgacaacttgacttctctggggactctgaacttccctggtcgaacagttttttctaatggctattcaagccccagcatgagaccagatgtaagctctcctccatccagctcctcaacagcaacaacaggaccacctcccaaactctgcctggtgtgctctgatgaagcttcaggatgtcattatggagtcttaacttgtggaagctgtaaagttttcttcaaaagagcagtggaaggacagcacaattacctatgtgctggaaggaatgattgcatcatcgataaaattcgaagaaaaaactgcccagcatgccgctatcgaaaatgtcttcaggctggaatgaacctggaagctcgaaaaacaaagaaaaaaataaaaggaattcagcaggccactacaggagtctcacaagaaacctctgaaaatcctggtaacaaaacaatagttcctgcaacgttaccacaactcacccctaccctggtgtcactgttggaggttattgaacctgaagtgttatatgcaggatatgatagctctgttccagactcaacttggaggatcatgactacgctcaacatgttaggagggcggcaagtgattgcagcagtgaaatgggcaaaggcaataccaggtttcaggaacttacacctggatgaccaaatgaccctactgcagtactcctggatgtttcttatggcatttgctctggggtggagatcatatagacaatcaagtgcaaacctgctgtgttttgctcctgatctgattattaatgagcagagaatgactctaccctgcatgtacgaccaatgtaaacacatgctgtatgtttcctctgagttacacaggcttcaggtatcttatgaagagtatctctgtatgaaaaccttactgcttctctcttcagttcctaaggacggtctgaagagccaagagctatttgatgaaattagaatgacctacatcaaagagctaggaaaagccattgtcaagagggaaggaaactccagccagaactggcagcggttttatcaactgacaaaactcttggattctatgcatgaagtggttgaaaatctccttaactattgcttccaaacatttttggataagaccatgagtattgaattccccgagatgttagctgaaatcatcaccaatcagataccaaaatattcaaatggaaatatcaaaaaacttctgtttcatcaaaagtga
Sequence Length
2334
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
49,802 Da
NCBI Official Full Name
Homo sapiens nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor), mRNA
NCBI Official Synonym Full Names
nuclear receptor subfamily 3 group C member 1
NCBI Official Symbol
NR3C1
NCBI Official Synonym Symbols
GR; GCR; GRL; GCCR; GCRST
NCBI Protein Information
glucocorticoid receptor
UniProt Protein Name
Glucocorticoid receptor
Protein Family
UniProt Gene Name
NR3C1
UniProt Synonym Gene Names
GRL; GR
UniProt Entry Name
GCR_HUMAN

NCBI Description

This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011]

Uniprot Description

GR: transcription factor of the nuclear receptor family. Receptor for glucocorticoids (GC). Binds to glucocorticoid response elements (GRE) and modulates other transcription factors. Affects inflammatory responses, cellular proliferation and differentiation in target tissues. Three alternatively spliced isoforms have been described.

Protein type: Transcription factor; DNA-binding; Nuclear receptor; Mitochondrial

Chromosomal Location of Human Ortholog: 5q31.3

Cellular Component: cytoplasm; mitochondrial matrix; nucleoplasm; nucleus; protein complex

Molecular Function: glucocorticoid receptor activity; protein binding; protein complex binding; steroid binding; transcription factor activity

Biological Process: positive regulation of transcription from RNA polymerase II promoter; regulation of transcription, DNA-dependent; signal transduction; transcription from RNA polymerase II promoter; transcription initiation from RNA polymerase II promoter; transcription, DNA-dependent

Disease: Glucocorticoid Resistance, Generalized

Research Articles on NR3C1

Similar Products

Product Notes

The NR3C1 nr3c1 (Catalog #AAA1277215) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactcca aagaatcatt aactcctggt agagaagaaa accccagcag tgtgcttgct caggagaggg gagatgtgat ggacttctat aaaaccctaa gaggaggagc tactgtgaag gtttctgcgt cttcaccctc actggctgtc gcttctcaat cagactccaa gcagcgaaga cttttggttg attttccaaa aggctcagta agcaatgcgc agcagccaga tctgtccaaa gcagtttcac tctcaatggg actgtatatg ggagagacag aaacaaaagt gatgggaaat gacctgggat tcccacagca gggccaaatc agcctttcct cgggggaaac agacttaaag cttttggaag aaagcattgc aaacctcaat aggtcgacca gtgttccaga gaaccccaag agttcagcat ccactgctgt gtctgctgcc cccacagaga aggagtttcc aaaaactcac tctgatgtat cttcagaaca gcaacatttg aagggccaga ctggcaccaa cggtggcaat gtgaaattgt ataccacaga ccaaagcacc tttgacattt tgcaggattt ggagttttct tctgggtccc caggtaaaga gacgaatgag agtccttgga gatcagacct gttgatagat gaaaactgtt tgctttctcc tctggcggga gaagacgatt cattcctttt ggaaggaaac tcgaatgagg actgcaagcc tctcatttta ccggacacta aacccaaaat taaggataat ggagatctgg ttttgtcaag ccccagtaat gtaacactgc cccaagtgaa aacagaaaaa gaagatttca tcgaactctg cacccctggg gtaattaagc aagagaaact gggcacagtt tactgtcagg caagctttcc tggagcaaat ataattggta ataaaatgtc tgccatttct gttcatggtg tgagtacctc tggaggacag atgtaccact atgacatgaa tacagcatcc ctttctcaac agcaggatca gaagcctatt tttaatgtca ttccaccaat tcccgttggt tccgaaaatt ggaataggtg ccaaggatct ggagatgaca acttgacttc tctggggact ctgaacttcc ctggtcgaac agttttttct aatggctatt caagccccag catgagacca gatgtaagct ctcctccatc cagctcctca acagcaacaa caggaccacc tcccaaactc tgcctggtgt gctctgatga agcttcagga tgtcattatg gagtcttaac ttgtggaagc tgtaaagttt tcttcaaaag agcagtggaa ggacagcaca attacctatg tgctggaagg aatgattgca tcatcgataa aattcgaaga aaaaactgcc cagcatgccg ctatcgaaaa tgtcttcagg ctggaatgaa cctggaagct cgaaaaacaa agaaaaaaat aaaaggaatt cagcaggcca ctacaggagt ctcacaagaa acctctgaaa atcctggtaa caaaacaata gttcctgcaa cgttaccaca actcacccct accctggtgt cactgttgga ggttattgaa cctgaagtgt tatatgcagg atatgatagc tctgttccag actcaacttg gaggatcatg actacgctca acatgttagg agggcggcaa gtgattgcag cagtgaaatg ggcaaaggca ataccaggtt tcaggaactt acacctggat gaccaaatga ccctactgca gtactcctgg atgtttctta tggcatttgc tctggggtgg agatcatata gacaatcaag tgcaaacctg ctgtgttttg ctcctgatct gattattaat gagcagagaa tgactctacc ctgcatgtac gaccaatgta aacacatgct gtatgtttcc tctgagttac acaggcttca ggtatcttat gaagagtatc tctgtatgaa aaccttactg cttctctctt cagttcctaa ggacggtctg aagagccaag agctatttga tgaaattaga atgacctaca tcaaagagct aggaaaagcc attgtcaaga gggaaggaaa ctccagccag aactggcagc ggttttatca actgacaaaa ctcttggatt ctatgcatga agtggttgaa aatctcctta actattgctt ccaaacattt ttggataaga ccatgagtat tgaattcccc gagatgttag ctgaaatcat caccaatcag ataccaaaat attcaaatgg aaatatcaaa aaacttctgt ttcatcaaaa gtga. It is sometimes possible for the material contained within the vial of "NR3C1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.