Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ABHD11 cdna clone

ABHD11 cDNA Clone

Gene Names
ABHD11; PP1226; WBSCR21
Synonyms
ABHD11; ABHD11 cDNA Clone; ABHD11 cdna clone
Ordering
For Research Use Only!
Sequence
atgagggccatcaacatcgcagatgagctgccccgctcccgtgcccgaaaactggcggatgaacagctcagttctgtcatccaggacatggccgtgcggcagcacctgctcactaacctggtagaggtagacgggcgcttcgtgtggagggtgaacttggatgccctgacccagcacctagacaagatcttggctttcccacagaggcaggagtcctacctcgggccaacactctttctccttggtggaaactcccagttcgtgcatcccagccaccaccctgagattatgcggctcttccctcgggcccagatgcagacggtgccgaacgctggccactggatccacgctgaccgcccacaggacttcatagctgccatccgaggcttcctggtctaa
Sequence Length
399
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,473 Da
NCBI Official Full Name
Homo sapiens abhydrolase domain containing 11, mRNA
NCBI Official Synonym Full Names
abhydrolase domain containing 11
NCBI Official Symbol
ABHD11
NCBI Official Synonym Symbols
PP1226; WBSCR21
NCBI Protein Information
protein ABHD11
UniProt Protein Name
Protein ABHD11
Protein Family
UniProt Gene Name
ABHD11
UniProt Synonym Gene Names
Abhydrolase domain-containing protein 11
UniProt Entry Name
ABHDB_HUMAN

NCBI Description

This gene encodes a protein containing an alpha/beta hydrolase fold domain. This gene is deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. [provided by RefSeq, Mar 2016]

Uniprot Description

ABHD11: ABHD11 is located in the Williams-Beuren syndrome (WBS) critical region. WBS results from a hemizygous deletion of several genes on chromosome 7q11.23, thought to arise as a consequence of unequal crossing over between highly homologous low-copy repeat sequences flanking the deleted region. Belongs to the AB hydrolase superfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Hydrolase; EC 3.-.-.-

Chromosomal Location of Human Ortholog: 7q11.23

Molecular Function: hydrolase activity

Research Articles on ABHD11

Similar Products

Product Notes

The ABHD11 abhd11 (Catalog #AAA1277214) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagggcca tcaacatcgc agatgagctg ccccgctccc gtgcccgaaa actggcggat gaacagctca gttctgtcat ccaggacatg gccgtgcggc agcacctgct cactaacctg gtagaggtag acgggcgctt cgtgtggagg gtgaacttgg atgccctgac ccagcaccta gacaagatct tggctttccc acagaggcag gagtcctacc tcgggccaac actctttctc cttggtggaa actcccagtt cgtgcatccc agccaccacc ctgagattat gcggctcttc cctcgggccc agatgcagac ggtgccgaac gctggccact ggatccacgc tgaccgccca caggacttca tagctgccat ccgaggcttc ctggtctaa. It is sometimes possible for the material contained within the vial of "ABHD11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.