Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDR73 cdna clone

WDR73 cDNA Clone

Gene Names
WDR73; GAMOS; HSPC264
Synonyms
WDR73; WDR73 cDNA Clone; WDR73 cdna clone
Ordering
For Research Use Only!
Sequence
atggatcctggggacgactggctggtggaatccttgcgcttgtaccaggatttctatgcattcgacctgtcaggagccactcgagtccttgaatggattgatgacaaaggagtctttgttgctggctatgaaagcctgaaaaagaatgaaattcttcatctgaaattacctctcagactttctgtaaaggaaaacaagggcttattcccagaaagagatttcaaagtgcgccatggaggattttcagacaggtctatctttgatctaaagcatgtgccacataccagattgctggttaccagtggccttccaggttgttatctgcaggtgtggcaggttgcagaggacagtgatgtcattaaagctgtcagcaccattgctgtgcatgagaaagaggagagtctctggcctagggtggccgtcttctccacattggcacccggagtcctccatggggcgaggctccgcagtctgcaggtcgttgatctggagtcccggaagaccacgtacacctcagatgtcagtgacagtgaggagctgagtagcctgcaggtcctagatgcagacacctttgccttctgctgtgcttcgggccggctggggcttgttgacacccggcagaagtgggcaccgttggagaatcgcagccctggccctgggtctggtggagagagatggtgtgctgaagttgggagctggggccagggccctgggcccagcattgccagccttggctcagatgggcgtctttgtcttcttgacccccgggatctctgccatcctgtgagctcagtccagtgcccagtatccgtacctagccctgacccagagctgctgcgagtgacttgggccccaggcctgaagaattgcttggccatctcaggttttgatggtacagtccaggtctatgatgccacatcttgggatggaacacggagccaagatggaacacggagccaagtagaacctctcttcactcacagaggtcacatcttcctagatggaaatgggatggaccctgctcctttggtcaccacccacacctggcatccctgcagaccaaggactttgttatcagcaacaaatgatgcctctctgcatgtgtgggactgggtggacctttgtgccccccgctga
Sequence Length
1137
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,685 Da
NCBI Official Full Name
Homo sapiens WD repeat domain 73, mRNA
NCBI Official Synonym Full Names
WD repeat domain 73
NCBI Official Symbol
WDR73
NCBI Official Synonym Symbols
GAMOS; HSPC264
NCBI Protein Information
WD repeat-containing protein 73
UniProt Protein Name
WD repeat-containing protein 73
UniProt Gene Name
WDR73
UniProt Entry Name
WDR73_HUMAN

NCBI Description

The protein encoded by this gene is thought to contain multiple WD40 repeats. WD40 repeats are motifs that contain 40-60 amino acids, and usually end with Trp-Asp (WD). This protein is found in the cytoplasm during interphase, but accumulates at the spindle poles and astral microtubules during mitosis. Reduced expression of this gene results in abnormalities in the size and morphology of the nucleus. Mutations in this gene have been associated with Galloway-Mowat syndrome PMID: 25466283), which is a rare autosomal recessive disorder that affects both the central nervous system and kidneys. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2015]

Uniprot Description

WDR73: Belongs to the WD repeat WDR73 family.

Chromosomal Location of Human Ortholog: 15q25.2

Disease: Galloway-mowat Syndrome

Research Articles on WDR73

Similar Products

Product Notes

The WDR73 wdr73 (Catalog #AAA1277186) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatcctg gggacgactg gctggtggaa tccttgcgct tgtaccagga tttctatgca ttcgacctgt caggagccac tcgagtcctt gaatggattg atgacaaagg agtctttgtt gctggctatg aaagcctgaa aaagaatgaa attcttcatc tgaaattacc tctcagactt tctgtaaagg aaaacaaggg cttattccca gaaagagatt tcaaagtgcg ccatggagga ttttcagaca ggtctatctt tgatctaaag catgtgccac ataccagatt gctggttacc agtggccttc caggttgtta tctgcaggtg tggcaggttg cagaggacag tgatgtcatt aaagctgtca gcaccattgc tgtgcatgag aaagaggaga gtctctggcc tagggtggcc gtcttctcca cattggcacc cggagtcctc catggggcga ggctccgcag tctgcaggtc gttgatctgg agtcccggaa gaccacgtac acctcagatg tcagtgacag tgaggagctg agtagcctgc aggtcctaga tgcagacacc tttgccttct gctgtgcttc gggccggctg gggcttgttg acacccggca gaagtgggca ccgttggaga atcgcagccc tggccctggg tctggtggag agagatggtg tgctgaagtt gggagctggg gccagggccc tgggcccagc attgccagcc ttggctcaga tgggcgtctt tgtcttcttg acccccggga tctctgccat cctgtgagct cagtccagtg cccagtatcc gtacctagcc ctgacccaga gctgctgcga gtgacttggg ccccaggcct gaagaattgc ttggccatct caggttttga tggtacagtc caggtctatg atgccacatc ttgggatgga acacggagcc aagatggaac acggagccaa gtagaacctc tcttcactca cagaggtcac atcttcctag atggaaatgg gatggaccct gctcctttgg tcaccaccca cacctggcat ccctgcagac caaggacttt gttatcagca acaaatgatg cctctctgca tgtgtgggac tgggtggacc tttgtgcccc ccgctga. It is sometimes possible for the material contained within the vial of "WDR73, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.