Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

AKAP9 cdna clone

AKAP9 cDNA Clone

Gene Names
AKAP9; LQT11; PRKA9; AKAP-9; CG-NAP; YOTIAO; AKAP350; AKAP450; PPP1R45; HYPERION; MU-RMS-40.16A
Synonyms
AKAP9; AKAP9 cDNA Clone; AKAP9 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggacgaggagagacagaagaagctggaggccggcaaagccaagcttgcccagtttcgacaaagaaaagctcagtcggatgggcagagtccttccaagaagcagaaaaaaaagagaaaaacgtcaagcagtaaacatgatgtgtcagcacaccatgatttgaatattgatcaatcacagtgtaatgaaatgtacataaatagttctcagagagtagaatcaactgtgattcctgaatctacaataatgagaactctacatagtggagaaataaccagtcatgagcagggcttctctgtggaactggaaagtgaaatttcaaccacagcagatgactgcagttcagaggtaaatggttgcagttttgtgatgagaacaggaaagcctacaaatttattaagggaagaagaatttggtgttgatgattcttattctgaacaaggagcacaagacagtccgactcatctagagatgatggaaagtgagttggctgggaagcagcatgagattgaagagctaaacagagagctggaagaaatgagggttacctatgggactgaaggactgcagcagttacaagaatttgaagctgccattaaacaaagagatggcattataacccagctcactgctaatttacaacaagcaagaagagaaaaggatgagacaatgagagaatttttagagttgacagaacagagtcaaaaattacagattcaatttcagcaattacaggctagtgaaactctgagaaacagcactcatagtagcacagctgcagacttactacaagccaaacaacagatcctcactcatcaacagcagcttgaagaacaagaccacttattagaagattatcagaaaaagaaagaagacttcacaatgcaaattagtttcttgcaagagaaaattaaagtatatgaaatggtatgtttattttaa
Sequence Length
945
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
455,423 Da
NCBI Official Full Name
Homo sapiens A kinase (PRKA) anchor protein (yotiao) 9, mRNA
NCBI Official Synonym Full Names
A-kinase anchoring protein 9
NCBI Official Symbol
AKAP9
NCBI Official Synonym Symbols
LQT11; PRKA9; AKAP-9; CG-NAP; YOTIAO; AKAP350; AKAP450; PPP1R45; HYPERION; MU-RMS-40.16A
NCBI Protein Information
A-kinase anchor protein 9
UniProt Protein Name
A-kinase anchor protein 9
Protein Family
UniProt Gene Name
AKAP9
UniProt Synonym Gene Names
AKAP350; AKAP450; KIAA0803; PRKA9
UniProt Entry Name
AKAP9_HUMAN

NCBI Description

The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternate splicing of this gene results in at least two isoforms that localize to the centrosome and the Golgi apparatus, and interact with numerous signaling proteins from multiple signal transduction pathways. These signaling proteins include type II protein kinase A, serine/threonine kinase protein kinase N, protein phosphatase 1, protein phosphatase 2a, protein kinase C-epsilon and phosphodiesterase 4D3. [provided by RefSeq, Aug 2008]

Uniprot Description

AKAP9: Binds to type II regulatory subunits of protein kinase A. Scaffolding protein that assembles several protein kinases and phosphatases on the centrosome and Golgi apparatus. May be required to maintain the integrity of the Golgi apparatus. Isoform 4 is associated with the N-methyl-D-aspartate receptor and is specifically found in the neuromuscular junction (NMJ) as well as in neuronal synapses, suggesting a role in the organization of postsynaptic specializations. Defects in AKAP9 are the cause of long QT syndrome type 11 (LQT11). Long QT syndromes are heart disorders characterized by a prolonged QT interval on the ECG and polymorphic ventricular arrhythmias. They cause syncope and sudden death in response to excercise or emotional stress. They can present with a sentinel event of sudden cardiac death in infancy. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 7q21-q22

Cellular Component: centrosome; cis-Golgi network; cytoskeleton; cytosol; Golgi apparatus; Golgi stack; intracellular membrane-bound organelle; voltage-gated potassium channel complex

Molecular Function: potassium channel regulator activity; protein binding; protein complex scaffold; Ras guanyl-nucleotide exchange factor activity; receptor binding

Biological Process: G2/M transition of mitotic cell cycle; MAPKKK cascade; microtubule nucleation; positive regulation of peptidyl-serine phosphorylation; signal transduction; synaptic transmission; transport

Disease: Long Qt Syndrome 11

Research Articles on AKAP9

Similar Products

Product Notes

The AKAP9 akap9 (Catalog #AAA1277122) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggacg aggagagaca gaagaagctg gaggccggca aagccaagct tgcccagttt cgacaaagaa aagctcagtc ggatgggcag agtccttcca agaagcagaa aaaaaagaga aaaacgtcaa gcagtaaaca tgatgtgtca gcacaccatg atttgaatat tgatcaatca cagtgtaatg aaatgtacat aaatagttct cagagagtag aatcaactgt gattcctgaa tctacaataa tgagaactct acatagtgga gaaataacca gtcatgagca gggcttctct gtggaactgg aaagtgaaat ttcaaccaca gcagatgact gcagttcaga ggtaaatggt tgcagttttg tgatgagaac aggaaagcct acaaatttat taagggaaga agaatttggt gttgatgatt cttattctga acaaggagca caagacagtc cgactcatct agagatgatg gaaagtgagt tggctgggaa gcagcatgag attgaagagc taaacagaga gctggaagaa atgagggtta cctatgggac tgaaggactg cagcagttac aagaatttga agctgccatt aaacaaagag atggcattat aacccagctc actgctaatt tacaacaagc aagaagagaa aaggatgaga caatgagaga atttttagag ttgacagaac agagtcaaaa attacagatt caatttcagc aattacaggc tagtgaaact ctgagaaaca gcactcatag tagcacagct gcagacttac tacaagccaa acaacagatc ctcactcatc aacagcagct tgaagaacaa gaccacttat tagaagatta tcagaaaaag aaagaagact tcacaatgca aattagtttc ttgcaagaga aaattaaagt atatgaaatg gtatgtttat tttaa. It is sometimes possible for the material contained within the vial of "AKAP9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.