Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FBXO3 cdna clone

FBXO3 cDNA Clone

Gene Names
FBXO3; FBA; FBX3
Synonyms
FBXO3; FBXO3 cDNA Clone; FBXO3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggccatggagaccgagacggcgccgctgaccctagagtcgctgcccaccgatcccctgctcctcatcttatcctttttggactatcgggatctaatcaactgttgttatgtcagtcgaagacttagccagctatcaagtcatgatccgctgtggagaagacattgcaaaaaatactggctgatatctgaggaagagaaaacacagaagaatcagtgttggaaatctctcttcatagatacttactctgatgtaggaagatacattgaccattatgctgctattaaaaaggcctgggatgatctcaagaaatatttggagcccaggtgtcctcggatggttttatctctgaaagagggtgctcgagaggaagacctcgatgctgtggaagcgcagattggctgcaagcttcctgacgattatcgatgttcataccgaattcacaatggacagaagttagtggttcctgggttattgggaagcatggcactgtctaatcactatcgttctgaagatttgttagacgtcgatacagctgccggaggattccagcagagacagggactgaaatactgtctccctttaactttttgcatacatactggtttgagtcagtacatagcagtggaagctgcagagggccgaaacaaaaatgaagttttctaccaatgtccagaccaaatggctcgaaatccagctgctattgacatgtttattataggtgctacttttactgactggtttacctcttatgtcaaaaatgttgtatcaggtggcttccccatcatcagagaccaaattttcagatatgttcacgatccagaatgtgtagcaacaactggggatattactgtgtcagtttccacatcgtttctgccagaacttagctctgtacatccaccccactatttcttcacataccgaatcaggattgaaatgtcaaaagatgcacttcctgagaaggcctgtcagttggacagtcgctattggagaataacaaatgctaagggtgacgtggaagaagttcaaggacctggagtagttggtgaatttccaatcatcagcccaggtcgggtatatgaatacacaagctgtaccacattctctacaacatcaggatacatggaaggatattataccttccattttctttactttaaagacaagatctttaatgttgccattccccgattccatatggcatgtccaacattcagggtgtctatagcccgattggaaatgggtcctgatgaatatgaagagatggaagaagaggaggaggaggaagaggaggaagacgaggatgatgattcagcagatatggatgaatcagatgaagatgatgaagaggagagacggaggagagtctttgatgttcccattcgcagacgccgctgctcacgccttttttag
Sequence Length
1416
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,975 Da
NCBI Official Full Name
Homo sapiens F-box protein 3, mRNA
NCBI Official Synonym Full Names
F-box protein 3
NCBI Official Symbol
FBXO3
NCBI Official Synonym Symbols
FBA; FBX3
NCBI Protein Information
F-box only protein 3
UniProt Protein Name
F-box only protein 3
Protein Family
UniProt Gene Name
FBXO3
UniProt Synonym Gene Names
FBX3
UniProt Entry Name
FBX3_HUMAN

NCBI Description

This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates 2 transcript variants diverging at the 3' end. [provided by RefSeq, Jul 2008]

Uniprot Description

FBXO3: Substrate recognition component of the SCF (SKP1-CUL1-F- box protein)-type E3 ubiquitin ligase complex. Mediates the ubiquitination of HIPK2 and probably that of EP300, leading to rapid degradation by the proteasome. In the presence of PML, HIPK2 ubiquitination still occurs, but degradation is prevented. PML, HIPK2 and FBXO3 may act synergically to activate p53/TP53- dependent transactivation. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 11p13

Cellular Component: cytoplasm; cytosol; nucleoplasm

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: protein polyubiquitination; proteolysis

Research Articles on FBXO3

Similar Products

Product Notes

The FBXO3 fbxo3 (Catalog #AAA1277079) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcca tggagaccga gacggcgccg ctgaccctag agtcgctgcc caccgatccc ctgctcctca tcttatcctt tttggactat cgggatctaa tcaactgttg ttatgtcagt cgaagactta gccagctatc aagtcatgat ccgctgtgga gaagacattg caaaaaatac tggctgatat ctgaggaaga gaaaacacag aagaatcagt gttggaaatc tctcttcata gatacttact ctgatgtagg aagatacatt gaccattatg ctgctattaa aaaggcctgg gatgatctca agaaatattt ggagcccagg tgtcctcgga tggttttatc tctgaaagag ggtgctcgag aggaagacct cgatgctgtg gaagcgcaga ttggctgcaa gcttcctgac gattatcgat gttcataccg aattcacaat ggacagaagt tagtggttcc tgggttattg ggaagcatgg cactgtctaa tcactatcgt tctgaagatt tgttagacgt cgatacagct gccggaggat tccagcagag acagggactg aaatactgtc tccctttaac tttttgcata catactggtt tgagtcagta catagcagtg gaagctgcag agggccgaaa caaaaatgaa gttttctacc aatgtccaga ccaaatggct cgaaatccag ctgctattga catgtttatt ataggtgcta cttttactga ctggtttacc tcttatgtca aaaatgttgt atcaggtggc ttccccatca tcagagacca aattttcaga tatgttcacg atccagaatg tgtagcaaca actggggata ttactgtgtc agtttccaca tcgtttctgc cagaacttag ctctgtacat ccaccccact atttcttcac ataccgaatc aggattgaaa tgtcaaaaga tgcacttcct gagaaggcct gtcagttgga cagtcgctat tggagaataa caaatgctaa gggtgacgtg gaagaagttc aaggacctgg agtagttggt gaatttccaa tcatcagccc aggtcgggta tatgaataca caagctgtac cacattctct acaacatcag gatacatgga aggatattat accttccatt ttctttactt taaagacaag atctttaatg ttgccattcc ccgattccat atggcatgtc caacattcag ggtgtctata gcccgattgg aaatgggtcc tgatgaatat gaagagatgg aagaagagga ggaggaggaa gaggaggaag acgaggatga tgattcagca gatatggatg aatcagatga agatgatgaa gaggagagac ggaggagagt ctttgatgtt cccattcgca gacgccgctg ctcacgcctt ttttag. It is sometimes possible for the material contained within the vial of "FBXO3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.