Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PER3 cdna clone

PER3 cDNA Clone

Gene Names
PER3; GIG13; FASPS3
Synonyms
PER3; PER3 cDNA Clone; PER3 cdna clone
Ordering
For Research Use Only!
Sequence
atgccccgcggggaagctcctggccccgggagacggggggctaaggacgaggccctgggcgaagaatcgggggagcggtggagccccgagttccatctgcagaggaaattggcggacagcagccacagtgaacagcaagatcgaaacagagtttctgaagaacttatcatggttgtccaagaaatgaaaaaatacttcccctcggagagacgcaataaaccaagcactctagatgccctcaactatgctctccgctgtgtccacagcgttcaagcaaacagtgagtttttccagattctcagtcagaatggagcacctcaggcagatgtgagcatgtacagtcttgaggagctggccactatcgcttcagaacacacttccaaaaacacagatacctttgtggcagtattttcatttctgtctggaaggttagtgcacatttctgaacaggctgctttgatcctgaatcgtaagaaagatgtcctggcgtcttctcactttgttgacctgcttgcacctcaagacatgagggtattctacgcgcacactgccagagctcagcttcctttctggaacaactggacccaaagagctgcacggtatgaatgtgctccggtgaaaccttttttctgcaggatccgtggaggtgaagacagaaagcaagagaagtgtcactccccattccggatcatcccctatctgattcatgtacatcaccctgcccagccagaattggaatcggaaccttgctgtctcactgtggttgaaaagattcactctggttatgaagctcctcggatcccagtgaataaaagaatcttcaccaccacacacaccccagggtgtgtttttcttgaagtagatgaaaaagcagtgcctttgctgggttacctacctcaggacctgattggaacatcgatcctaagctacctgcaccctgaagatcgttctctgatggttgccatacaccaaaaagttttgaagtatgcagggcatcctccctttgaacattctcccattcgattttgtactcaaaacggagactacatcatactggattccagttggtccagctttgtgaatccctggagccggaagatttctttcatcattggtcggcataaagttcgaacgtaa
Sequence Length
1137
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
132,660 Da
NCBI Official Full Name
Homo sapiens period homolog 3 (Drosophila), mRNA
NCBI Official Synonym Full Names
period circadian clock 3
NCBI Official Symbol
PER3
NCBI Official Synonym Symbols
GIG13; FASPS3
NCBI Protein Information
period circadian protein homolog 3
UniProt Protein Name
Period circadian protein homolog 3
Protein Family
UniProt Gene Name
PER3
UniProt Synonym Gene Names
hPER3
UniProt Entry Name
PER3_HUMAN

NCBI Description

This gene is a member of the Period family of genes and is expressed in a circadian pattern in the suprachiasmatic nucleus, the primary circadian pacemaker in the mammalian brain. Genes in this family encode components of the circadian rhythms of locomotor activity, metabolism, and behavior. This gene is upregulated by CLOCK/ARNTL heterodimers but then represses this upregulation in a feedback loop using PER/CRY heterodimers to interact with CLOCK/ARNTL. Polymorphisms in this gene have been linked to sleep disorders. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2014]

Uniprot Description

PER3: Component of the circadian clock mechanism which is essential for generating circadian rhythms. Can bind heme. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 1p36.23

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding

Biological Process: negative regulation of transcription from RNA polymerase II promoter; protein stabilization; regulation of circadian sleep/wake cycle, sleep

Disease: Advanced Sleep Phase Syndrome, Familial, 3

Research Articles on PER3

Similar Products

Product Notes

The PER3 per3 (Catalog #AAA1276932) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccccgcg gggaagctcc tggccccggg agacgggggg ctaaggacga ggccctgggc gaagaatcgg gggagcggtg gagccccgag ttccatctgc agaggaaatt ggcggacagc agccacagtg aacagcaaga tcgaaacaga gtttctgaag aacttatcat ggttgtccaa gaaatgaaaa aatacttccc ctcggagaga cgcaataaac caagcactct agatgccctc aactatgctc tccgctgtgt ccacagcgtt caagcaaaca gtgagttttt ccagattctc agtcagaatg gagcacctca ggcagatgtg agcatgtaca gtcttgagga gctggccact atcgcttcag aacacacttc caaaaacaca gatacctttg tggcagtatt ttcatttctg tctggaaggt tagtgcacat ttctgaacag gctgctttga tcctgaatcg taagaaagat gtcctggcgt cttctcactt tgttgacctg cttgcacctc aagacatgag ggtattctac gcgcacactg ccagagctca gcttcctttc tggaacaact ggacccaaag agctgcacgg tatgaatgtg ctccggtgaa accttttttc tgcaggatcc gtggaggtga agacagaaag caagagaagt gtcactcccc attccggatc atcccctatc tgattcatgt acatcaccct gcccagccag aattggaatc ggaaccttgc tgtctcactg tggttgaaaa gattcactct ggttatgaag ctcctcggat cccagtgaat aaaagaatct tcaccaccac acacacccca gggtgtgttt ttcttgaagt agatgaaaaa gcagtgcctt tgctgggtta cctacctcag gacctgattg gaacatcgat cctaagctac ctgcaccctg aagatcgttc tctgatggtt gccatacacc aaaaagtttt gaagtatgca gggcatcctc cctttgaaca ttctcccatt cgattttgta ctcaaaacgg agactacatc atactggatt ccagttggtc cagctttgtg aatccctgga gccggaagat ttctttcatc attggtcggc ataaagttcg aacgtaa. It is sometimes possible for the material contained within the vial of "PER3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.