Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MLH1 cdna clone

MLH1 cDNA Clone

Gene Names
MLH1; FCC2; COCA2; HNPCC; hMLH1; HNPCC2
Synonyms
MLH1; MLH1 cDNA Clone; MLH1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgttcgtggcaggggttattcggcggctggacgagacagtggtgaaccgcatcgcggcgggggaagttatccagcggccagctaatgctatcaaagagatgattgagaactgtttagatgcaaaatccacaagtattcaagtgattgttaaagagggaggcctgaagttgattcagatccaagacaatggcaccgggatcaggaaagaagatctggatattgtatgtgaaaggttcactactagtaaactgcagtcctttgaggatttagccagtatttctacctatggctttcgaggtgaggctttggccagcataagccatgtggctcatgttactattacaacgaaaacagctgatggaaagtgtgcatacagagcaagttactcagatggaaaactgaaagcccctcctaaaccatgtgctggcaatcaagggacccagatcacggtggaggaccttttttacaacatagccacgaggagaaaagctttaaaaaatccaagtgaagaatatgggaaaattttggaagttgttggcaggtattcagtacacaatgcaggcattagtttctcagttaaaaaacaaggagagacagtagctgatgttaggacactacccaatgcctcaaccgtggacaatattcgctccatctttggaaatgctgttagtcgagaactgatagaaattggatgtgaggataaaaccctagccttcaaaatgaatggttacatatccaatgcaaactactcagtgaagaagtgcatcttcttactcttcatcaaccatcgtctggtagaatcaacttccttgagaaaagccatagaaacagtgtatgcagcctatttgcccaaaaacacacacccattcctgtacctcagtttagaaatcagtccccagaatgtggatgttaatgtgcaccccacaaagcatgaagttcacttcctgcacgaggagagcatcctggagcgggtgcagcagcacatcgagagcaagctcctgggctccaattcctccaggatgtacttcacccagactttgctaccaggacttgctggcccctctggggagatggttaaatccacaacaagtctgacctcgtcttctacttctggaagtagtgataaggtctatgcccaccagatggttcgtacagattcccgggaacagaagcttgatgcatttctgcagcctctgagcaaacccctgtccagtcagccccaggccattgtcacagaggataagacagatatttctagtggcagggctaggcagcaagatgaggagatgcttgaactcccagcccctgctgaagtggctgccaaaaatcagagcttggagggggatacaacaaaggggacttcagaaatgtcagagaagagaggacctacttccagcaaccccagaaagagacatcgggaagattctgatgtggaaatggtggaagatgattcccgaaaggaaatgactgcagcttgtaccccccggagaaggatcattaacctcactagtgttttgagtctccaggaagaaattaatgagcagggacatgaggttctccgggagatgttgcataaccactccttcgtgggctgtgtgaatcctcagtgggccttggcacagcatcaaaccaagttataccttctcaacaccaccaagcttagtgaagaactgttctaccagatactcatttatgattttgccaattttggtgttctcaggttatcggagccagcaccgctctttgaccttgccatgcttgccttagatagtccagagagtggctggacagaggaagatggtcccaaagaaggacttgctgaatacattgttgagtttctgaagaagaaggctgagatgcttgcagactatttctctttggaaattgatgaggaagggaacctgattggattaccccttctgattgacaactatgtgccccctttggagggactgcctatcttcattcttcgactagccactgaggtgaattgggacgaagaaaaggaatgttttgaaagcctcagtaaagaatgcgctatgttctattccatccggaagcagtacatatctgaggagtcgaccctctcaggccagcagagtgaagtgcctggctccattccaaactcctggaagtggactgtggaacacattgtctataaagccttgcgctcacacattctgcctcctaaacatttcacagaagatggaaatatcctgcagcttgctaacctgcctgatctatacaaagtctttgagaggtgttaa
Sequence Length
2271
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
73,837 Da
NCBI Official Full Name
Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli), mRNA
NCBI Official Synonym Full Names
mutL homolog 1
NCBI Official Symbol
MLH1
NCBI Official Synonym Symbols
FCC2; COCA2; HNPCC; hMLH1; HNPCC2
NCBI Protein Information
DNA mismatch repair protein Mlh1
UniProt Protein Name
DNA mismatch repair protein Mlh1
Protein Family
UniProt Gene Name
MLH1
UniProt Synonym Gene Names
COCA2
UniProt Entry Name
MLH1_HUMAN

NCBI Description

This gene was identified as a locus frequently mutated in hereditary nonpolyposis colon cancer (HNPCC). It is a human homolog of the E. coli DNA mismatch repair gene mutL, consistent with the characteristic alterations in microsatellite sequences (RER+phenotype) found in HNPCC. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants have been described, but their full-length natures have not been determined.[provided by RefSeq, Nov 2009]

Uniprot Description

MLH1: a protein involved in the repair of mismatches in DNA. Binds PMS2 or MLH1 and MLH3. Part of the BRCA1-associated genome surveillance complex (BASC), which contains BRCA1, MSH2, MSH6, MLH1, ATM, BLM, PMS2 and the RAD50- MRE11-NBS1 protein complex. This association could be a dynamic process changing throughout the cell cycle and within subnuclear domains. Interacts with MBD4. Interacts with EXO1. Defects in MLH1 are the cause of hereditary non-polyposis colorectal cancer type 2; Turcot syndrome, an autosomal dominant disorder characterized by malignant tumors of the brain; Muir-Torre syndrome (MTS), a rare autosomal dominant disorder characterized by sebaceous neoplasms and visceral malignancy; lobular carcinoma in situ; endometrial cancer; and non-polyposis colorectal cancer.

Protein type: Cell cycle regulation; Tumor suppressor; DNA repair, damage

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: chiasma; membrane; MutLalpha complex; nucleoplasm; nucleus; synaptonemal complex

Molecular Function: ATPase activity; MutSalpha complex binding; protein binding; single-stranded DNA binding

Biological Process: mismatch repair; somatic hypermutation of immunoglobulin genes

Disease: Colorectal Cancer, Hereditary Nonpolyposis, Type 2; Mismatch Repair Cancer Syndrome; Muir-torre Syndrome

Research Articles on MLH1

Similar Products

Product Notes

The MLH1 mlh1 (Catalog #AAA1276873) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgttcg tggcaggggt tattcggcgg ctggacgaga cagtggtgaa ccgcatcgcg gcgggggaag ttatccagcg gccagctaat gctatcaaag agatgattga gaactgttta gatgcaaaat ccacaagtat tcaagtgatt gttaaagagg gaggcctgaa gttgattcag atccaagaca atggcaccgg gatcaggaaa gaagatctgg atattgtatg tgaaaggttc actactagta aactgcagtc ctttgaggat ttagccagta tttctaccta tggctttcga ggtgaggctt tggccagcat aagccatgtg gctcatgtta ctattacaac gaaaacagct gatggaaagt gtgcatacag agcaagttac tcagatggaa aactgaaagc ccctcctaaa ccatgtgctg gcaatcaagg gacccagatc acggtggagg acctttttta caacatagcc acgaggagaa aagctttaaa aaatccaagt gaagaatatg ggaaaatttt ggaagttgtt ggcaggtatt cagtacacaa tgcaggcatt agtttctcag ttaaaaaaca aggagagaca gtagctgatg ttaggacact acccaatgcc tcaaccgtgg acaatattcg ctccatcttt ggaaatgctg ttagtcgaga actgatagaa attggatgtg aggataaaac cctagccttc aaaatgaatg gttacatatc caatgcaaac tactcagtga agaagtgcat cttcttactc ttcatcaacc atcgtctggt agaatcaact tccttgagaa aagccataga aacagtgtat gcagcctatt tgcccaaaaa cacacaccca ttcctgtacc tcagtttaga aatcagtccc cagaatgtgg atgttaatgt gcaccccaca aagcatgaag ttcacttcct gcacgaggag agcatcctgg agcgggtgca gcagcacatc gagagcaagc tcctgggctc caattcctcc aggatgtact tcacccagac tttgctacca ggacttgctg gcccctctgg ggagatggtt aaatccacaa caagtctgac ctcgtcttct acttctggaa gtagtgataa ggtctatgcc caccagatgg ttcgtacaga ttcccgggaa cagaagcttg atgcatttct gcagcctctg agcaaacccc tgtccagtca gccccaggcc attgtcacag aggataagac agatatttct agtggcaggg ctaggcagca agatgaggag atgcttgaac tcccagcccc tgctgaagtg gctgccaaaa atcagagctt ggagggggat acaacaaagg ggacttcaga aatgtcagag aagagaggac ctacttccag caaccccaga aagagacatc gggaagattc tgatgtggaa atggtggaag atgattcccg aaaggaaatg actgcagctt gtaccccccg gagaaggatc attaacctca ctagtgtttt gagtctccag gaagaaatta atgagcaggg acatgaggtt ctccgggaga tgttgcataa ccactccttc gtgggctgtg tgaatcctca gtgggccttg gcacagcatc aaaccaagtt ataccttctc aacaccacca agcttagtga agaactgttc taccagatac tcatttatga ttttgccaat tttggtgttc tcaggttatc ggagccagca ccgctctttg accttgccat gcttgcctta gatagtccag agagtggctg gacagaggaa gatggtccca aagaaggact tgctgaatac attgttgagt ttctgaagaa gaaggctgag atgcttgcag actatttctc tttggaaatt gatgaggaag ggaacctgat tggattaccc cttctgattg acaactatgt gccccctttg gagggactgc ctatcttcat tcttcgacta gccactgagg tgaattggga cgaagaaaag gaatgttttg aaagcctcag taaagaatgc gctatgttct attccatccg gaagcagtac atatctgagg agtcgaccct ctcaggccag cagagtgaag tgcctggctc cattccaaac tcctggaagt ggactgtgga acacattgtc tataaagcct tgcgctcaca cattctgcct cctaaacatt tcacagaaga tggaaatatc ctgcagcttg ctaacctgcc tgatctatac aaagtctttg agaggtgtta a. It is sometimes possible for the material contained within the vial of "MLH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.