Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PCMTD1 cdna clone

PCMTD1 cDNA Clone

Synonyms
PCMTD1; PCMTD1 cDNA Clone; PCMTD1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggaggagctgtgagtgctggggaagataatgatgacttaattgataatttaaaagaagctcagtatattcgtactgaaagagtggagcaagccttcagagcgattgatcgtggagattactatttggaaggctacagagacaatgcttacaaagacttagcctggaagcatggaaacatccacttgtcagcaccttgcatttattctgaagttatggaagcattgaaacttcaaccaggattgtcttttcttaacctgggaagtggaaccggatatttaagtacaatggtgggcttaattttaggtccttttggaataaatcatgggattgagcttcattcagatgtggtggaatatgccaaggaaaaactggagagcttcatcaaaaatagtgatagctttgataaatttgagttctgtgaacctgcatttgttgttggtaattgcctccagatagcttctgacagtcatcagtatgatcgaatttattgtggagctggagtacagaaagaccatgaaaactacatgaaaatattactaaaagttggaggcatattagtcatgcctatagaggatcagttaacacagattatgcgaactggacagaacacttgggaaagtaaaaatatccttgctgtttcatttgctccacttgtgcaaccaagtaagaatgataatggcaaaccagattctgtgggactccctccctgtgctgtcaggaatctacaggacttggctcgtatttacattcgacgcacacttagaaatttcataaatgatgagatgcaggccaaggggattcctcaaagggctccacccaaaaggaaaagaaagagagttaaacagagaattaacacttacgtatttgtgggtaatcagcttattcctcagcctctagacagtgaagaggatgaaaaaatggaagaggatatcaaagaagaggaggaaaaagatcacaatgaagcaatgaagccagaggagccacctcaaaatttactgagagaaaaaatcatgaagctgcccctccctgaatctttaaaagcttacttgacatattttagagacaaataa
Sequence Length
1074
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,197 Da
NCBI Official Full Name
Homo sapiens protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1, mRNA
NCBI Official Synonym Full Names
protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1
NCBI Official Symbol
PCMTD1
NCBI Protein Information
protein-L-isoaspartate O-methyltransferase domain-containing protein 1
UniProt Protein Name
Protein-L-isoaspartate O-methyltransferase domain-containing protein 1
UniProt Gene Name
PCMTD1
UniProt Entry Name
PCMD1_HUMAN

Uniprot Description

PCMTD1: Belongs to the methyltransferase superfamily. L- isoaspartyl/D-aspartyl protein methyltransferase family. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 8q11.23

Cellular Component: cytoplasm

Molecular Function: protein-L-isoaspartate (D-aspartate) O-methyltransferase activity

Research Articles on PCMTD1

Similar Products

Product Notes

The PCMTD1 pcmtd1 (Catalog #AAA1276794) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggaggag ctgtgagtgc tggggaagat aatgatgact taattgataa tttaaaagaa gctcagtata ttcgtactga aagagtggag caagccttca gagcgattga tcgtggagat tactatttgg aaggctacag agacaatgct tacaaagact tagcctggaa gcatggaaac atccacttgt cagcaccttg catttattct gaagttatgg aagcattgaa acttcaacca ggattgtctt ttcttaacct gggaagtgga accggatatt taagtacaat ggtgggctta attttaggtc cttttggaat aaatcatggg attgagcttc attcagatgt ggtggaatat gccaaggaaa aactggagag cttcatcaaa aatagtgata gctttgataa atttgagttc tgtgaacctg catttgttgt tggtaattgc ctccagatag cttctgacag tcatcagtat gatcgaattt attgtggagc tggagtacag aaagaccatg aaaactacat gaaaatatta ctaaaagttg gaggcatatt agtcatgcct atagaggatc agttaacaca gattatgcga actggacaga acacttggga aagtaaaaat atccttgctg tttcatttgc tccacttgtg caaccaagta agaatgataa tggcaaacca gattctgtgg gactccctcc ctgtgctgtc aggaatctac aggacttggc tcgtatttac attcgacgca cacttagaaa tttcataaat gatgagatgc aggccaaggg gattcctcaa agggctccac ccaaaaggaa aagaaagaga gttaaacaga gaattaacac ttacgtattt gtgggtaatc agcttattcc tcagcctcta gacagtgaag aggatgaaaa aatggaagag gatatcaaag aagaggagga aaaagatcac aatgaagcaa tgaagccaga ggagccacct caaaatttac tgagagaaaa aatcatgaag ctgcccctcc ctgaatcttt aaaagcttac ttgacatatt ttagagacaa ataa. It is sometimes possible for the material contained within the vial of "PCMTD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.