Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TTLL2 cdna clone

TTLL2 cDNA Clone

Gene Names
TTLL2; C6orf104; NYD-TSPG; dJ366N23.3
Synonyms
TTLL2; TTLL2 cDNA Clone; TTLL2 cdna clone
Ordering
For Research Use Only!
Sequence
atgagagggcgggacctgtgttcctccacacaaagccaggcgctgggatctttgagaaccaccaccccagcctttacccttaacattccatccgaggcaaaccacactgagcagccgcctgcaggcctgggagcaaggctacaggaagcaggtgtttccatccctcccaggcgaggccgcccaacaccaacactggagaagaagaaaaaacctcatttgatggcggaagatgaaccttcaggggccctcttgaagccgctggtttttcgcgttgacgagaccaccccggctgtggtgcaaagtgtcctcctggagagggggtggaataagtttgataagcaggagcagaacgcggaggactggaacctgtactggagggcatcctctttccgaatgaccgaacacaacagtgttaaaccgtggcagcagctaaaccaccaccctggaaccaccaagcttaccaggaaagactgtttggccaaacacctgaagcacatgaggaggatgtatggcacttccctgtaccagttcatccccctgacgttcgtcatgcccaatgactataccaagttcgtggctgaatactttcaggagaggcagatgctgggcaccaagcatagctattggatttgcaagcctgctgagttatctcgtgggagggggatactaattttcagtgactttaaagacttcatctttgatgatatgtacatagtgcagaaatatatctccaatcctttacttattggcagatataaatgtgatctccgcatctatgtttgtgttactggctttaagcctttgaccatttatgtttatcaggaagggttggttcggtttgccacggaaaagtttgacctcagtaatttgcaaaacaattatgcccatttgaccaacagcagcatcaataaatccggggcctcttatgagaagatcaaagaagtgattggtcatggttgtaaatggacgctcagcagatttttttcctaccttcgtagctgggatgtggacgatctgcttttgtggaagaaaatccaccgcatggttattctcaccattctcgccattgcaccatctgtcccctttgctgccaattgctttgagctctttgggtttgatattttgattgatgacaacttgaaaccatggcttttagaggtcaactacagcccagccttgaccttggattgttcaacagatgtgttggtgaagagaaaacttgtccatgatattattgacctgatttacttaaatggtctaagaaatgaggggggagaagccagtaatgccacacatggaaattccaacatcgatgctgcaaaaagtgacagaggtgggcttgatgctcctgactgtcttccttatgattctctttcgttcacaagcagaatgtacaacgaggatgactctgtggtggagaaagctgtgagtgtgcgtcctgaagctgcacctgcctcccagctggaaggagagatgagtgggcaggattttcatctgtcaacaagggagatgccacaaagcaagcccaagttacggagcaggcacacgcctcacaagacactcatgccctacgcgtccctcttccagtcgcactcctgcaagaccaagacctccccgtgtgtcctgtcagaccgtggcaaagctccagatccccaagcaggcaactttgttcttgtttttcctttcaatgaagcaactctcggagcttccaggaatggattaaatgtcaaaagaataatccaagagctccagaaactaatgaataagcaacattcctaa
Sequence Length
1779
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
67,336 Da
NCBI Official Full Name
Homo sapiens tubulin tyrosine ligase-like family, member 2, mRNA
NCBI Official Synonym Full Names
tubulin tyrosine ligase like 2
NCBI Official Symbol
TTLL2
NCBI Official Synonym Symbols
C6orf104; NYD-TSPG; dJ366N23.3
NCBI Protein Information
probable tubulin polyglutamylase TTLL2
UniProt Protein Name
Probable tubulin polyglutamylase TTLL2
UniProt Gene Name
TTLL2
UniProt Synonym Gene Names
C6orf104
UniProt Entry Name
TTLL2_HUMAN

Uniprot Description

TTLL2: Probable tubulin polyglutamylase that forms polyglutamate side chains on tubulin. Probably acts when complexed with other proteins. Belongs to the tubulin--tyrosine ligase family.

Protein type: EC 6.-.-.-; Ligase

Chromosomal Location of Human Ortholog: 6q27

Research Articles on TTLL2

Similar Products

Product Notes

The TTLL2 ttll2 (Catalog #AAA1276774) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagagggc gggacctgtg ttcctccaca caaagccagg cgctgggatc tttgagaacc accaccccag cctttaccct taacattcca tccgaggcaa accacactga gcagccgcct gcaggcctgg gagcaaggct acaggaagca ggtgtttcca tccctcccag gcgaggccgc ccaacaccaa cactggagaa gaagaaaaaa cctcatttga tggcggaaga tgaaccttca ggggccctct tgaagccgct ggtttttcgc gttgacgaga ccaccccggc tgtggtgcaa agtgtcctcc tggagagggg gtggaataag tttgataagc aggagcagaa cgcggaggac tggaacctgt actggagggc atcctctttc cgaatgaccg aacacaacag tgttaaaccg tggcagcagc taaaccacca ccctggaacc accaagctta ccaggaaaga ctgtttggcc aaacacctga agcacatgag gaggatgtat ggcacttccc tgtaccagtt catccccctg acgttcgtca tgcccaatga ctataccaag ttcgtggctg aatactttca ggagaggcag atgctgggca ccaagcatag ctattggatt tgcaagcctg ctgagttatc tcgtgggagg gggatactaa ttttcagtga ctttaaagac ttcatctttg atgatatgta catagtgcag aaatatatct ccaatccttt acttattggc agatataaat gtgatctccg catctatgtt tgtgttactg gctttaagcc tttgaccatt tatgtttatc aggaagggtt ggttcggttt gccacggaaa agtttgacct cagtaatttg caaaacaatt atgcccattt gaccaacagc agcatcaata aatccggggc ctcttatgag aagatcaaag aagtgattgg tcatggttgt aaatggacgc tcagcagatt tttttcctac cttcgtagct gggatgtgga cgatctgctt ttgtggaaga aaatccaccg catggttatt ctcaccattc tcgccattgc accatctgtc ccctttgctg ccaattgctt tgagctcttt gggtttgata ttttgattga tgacaacttg aaaccatggc ttttagaggt caactacagc ccagccttga ccttggattg ttcaacagat gtgttggtga agagaaaact tgtccatgat attattgacc tgatttactt aaatggtcta agaaatgagg ggggagaagc cagtaatgcc acacatggaa attccaacat cgatgctgca aaaagtgaca gaggtgggct tgatgctcct gactgtcttc cttatgattc tctttcgttc acaagcagaa tgtacaacga ggatgactct gtggtggaga aagctgtgag tgtgcgtcct gaagctgcac ctgcctccca gctggaagga gagatgagtg ggcaggattt tcatctgtca acaagggaga tgccacaaag caagcccaag ttacggagca ggcacacgcc tcacaagaca ctcatgccct acgcgtccct cttccagtcg cactcctgca agaccaagac ctccccgtgt gtcctgtcag accgtggcaa agctccagat ccccaagcag gcaactttgt tcttgttttt cctttcaatg aagcaactct cggagcttcc aggaatggat taaatgtcaa aagaataatc caagagctcc agaaactaat gaataagcaa cattcctaa. It is sometimes possible for the material contained within the vial of "TTLL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.