Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ASB9 cdna clone

ASB9 cDNA Clone

Synonyms
ASB9; ASB9 cDNA Clone; ASB9 cdna clone
Ordering
For Research Use Only!
Sequence
atggatggcaaacaagggggcatggatgggagcaagcccgcggggccaagggactttcctggcatcaggcttctttcaaacccattgatgggcgatgctgtgtctgattggtctcctatgcatgaagctgcaatccacggacatcagctgtctctgaggaacctcatcagccaggggtgggctgtgaacatcatcacggcagatcatgtttccccactccatgaagcctgtcttggaggtcatctctcttgtgtgaagattttattaaagcatggagctcaggtgaatggtgtgacagcagactggcacactccactgtttaatgcttgtgtcagcggcagctgggattgtgtgaatttgcttctgcagcacggagccagcgttcaacctgagagtgatctggcatcccccatccatgaagctgctaggagagcttatgggggcaacattgaccataagatcagccacctgggcactccactctatttggcttgtgaaaaccaacagagagcctgtgtcaagaagcttctggagtcaggagcggacgtgaaccaagggaaaggtcaggattccccacttcatgcagtggccaggacagccagtgaagagctggcctgcctgctcatggattttggagcggacacccaggccaagaatgctgaaggcaaacgtcctgtggagctggtgcctccagagagccccttggcccagctcttcttggagagagaaggtgcttctttgccaaaacctaagccctaa
Sequence Length
759
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,849 Da
NCBI Official Full Name
Homo sapiens ankyrin repeat and SOCS box-containing 9, mRNA
NCBI Official Synonym Full Names
ankyrin repeat and SOCS box containing 9
NCBI Official Symbol
ASB9
NCBI Protein Information
ankyrin repeat and SOCS box protein 9
UniProt Protein Name
Ankyrin repeat and SOCS box protein 9
UniProt Gene Name
ASB9
UniProt Synonym Gene Names
ASB-9
UniProt Entry Name
ASB9_HUMAN

NCBI Description

This gene encodes a member of the ankyrin repeat and suppressor of cytokine signaling (SOCS) box protein family. Members of this family can interact with the elongin B-C adapter complex via their SOCS box domain and further complex with the cullin and ring box proteins to form E3 ubiquitin ligase complexes. They may function to mediate the substrate-recognition of the E3 ubiquitin ligases. A transcribed pseudogene of this gene has been identified on chromosome 15. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]

Uniprot Description

ASB9: Substrate-recognition component of a SCF-like ECS (Elongin-Cullin-SOCS-box protein) E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins. Recognizes at least two forms of creatine kinase, CKB and CKMT1A. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: Xp22.2

Molecular Function: protein binding

Biological Process: positive regulation of protein catabolic process; protein ubiquitination

Research Articles on ASB9

Similar Products

Product Notes

The ASB9 asb9 (Catalog #AAA1276708) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatggca aacaaggggg catggatggg agcaagcccg cggggccaag ggactttcct ggcatcaggc ttctttcaaa cccattgatg ggcgatgctg tgtctgattg gtctcctatg catgaagctg caatccacgg acatcagctg tctctgagga acctcatcag ccaggggtgg gctgtgaaca tcatcacggc agatcatgtt tccccactcc atgaagcctg tcttggaggt catctctctt gtgtgaagat tttattaaag catggagctc aggtgaatgg tgtgacagca gactggcaca ctccactgtt taatgcttgt gtcagcggca gctgggattg tgtgaatttg cttctgcagc acggagccag cgttcaacct gagagtgatc tggcatcccc catccatgaa gctgctagga gagcttatgg gggcaacatt gaccataaga tcagccacct gggcactcca ctctatttgg cttgtgaaaa ccaacagaga gcctgtgtca agaagcttct ggagtcagga gcggacgtga accaagggaa aggtcaggat tccccacttc atgcagtggc caggacagcc agtgaagagc tggcctgcct gctcatggat tttggagcgg acacccaggc caagaatgct gaaggcaaac gtcctgtgga gctggtgcct ccagagagcc ccttggccca gctcttcttg gagagagaag gtgcttcttt gccaaaacct aagccctaa. It is sometimes possible for the material contained within the vial of "ASB9, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.