THUMPD2 cdna clone
THUMPD2 cDNA Clone
Gene Names
THUMPD2; C2orf8
Synonyms
THUMPD2; THUMPD2 cDNA Clone; THUMPD2 cdna clone
Sequence
atgcgagaggtgcgggcgcggctggcggccacgcaggttgaatatatttcaggaaaggtttttttcaccacctgttctgatttgaatatgttgaagaaattaaaatctgcagaaagattatttttgctgattaaaaagcagtttccacttattatttcttctgtaagtaaaggaaaaatatttaatgaaatgcaaagacttataaatgaagatccaggaagttggttgaatgccatttcaatttggaaaaatcttcttgaacttgatgcaaaaaaggaaaaactttctcagagagatgataaccaactaaaaagaaaagtgggagaaaatgaaatcattgcaaagaaattaaaaatagaacaaatgcaaaagatagaagagaatagggactgccagctggaaaaacaaataaaagaagaaactctggagcaaagagattttaccactaaaagcgaaaagtttcaagaagaagaatttcagaatgacatagagaaagcaattgatactcataatcagaatgacttgactttcagagtatcttgtcgctgcagtggaactattggaaaggccttcactgcacaggaggtaggaaaagtaattggaattgctattatgaaacactttggatggaaagcagacttgaggaatccacaattagagatctttatacatctaaatgacatttactctgtggtggggattcctgtgttcagggtttccctagccagcagagcttacatcaagacagctggactgcgatctacaatagcgtgggcaatggcatctctggctgacattaaggctggtgcatttgttttagatccaatgtgtggacttggaacaatacttttggaagctgctaaagaatggccagatgtgtattatgtaggtgctgatgtcagcgactcacagttactaggtacttgggacaatctgaaagctgcaggccttgaggataaaattgaattacttaaaatctctgttatagaattgccattgccttcagaaagtgttgatattattatttctgacattccatttgggaaaaagtttaagttaggaaaagacatcaaaagcattctacaagaaatggaaagagtgcttcatgttggcggaaccattgtattgttgcttagtgaagatcaccacaggcgccttacagattgtaaagagagcaacatccctttcaattccaaggacagtcacacagatgaacctggaattaaaaagtgcttgaatcctgaagaaaaaactggtgcattcaagacagcgtcaacttcattcgaagccagtaaccacaaattcttagacagaatgtcaccatttggctccttggtaccagtggaatgctacaaagttagccttggaaagacagatgcgttcatatgtaaatataagaagtcgcactcttctggactgtag
Sequence Length
1422
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
34,414 Da
NCBI Official Full Name
Homo sapiens THUMP domain containing 2, mRNA
NCBI Official Synonym Full Names
THUMP domain containing 2
NCBI Official Symbol
THUMPD2
NCBI Official Synonym Symbols
C2orf8
NCBI Protein Information
THUMP domain-containing protein 2
UniProt Protein Name
THUMP domain-containing protein 2
Protein Family
UniProt Gene Name
THUMPD2
UniProt Synonym Gene Names
C2orf8
UniProt Entry Name
THUM2_HUMAN
Uniprot Description
THUMPD2: Belongs to the methyltransferase superfamily. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 2p22.1|2p22-p21
Molecular Function: tRNA (guanine) methyltransferase activity; tRNA binding
Biological Process: tRNA methylation
Similar Products
Product Notes
The THUMPD2 thumpd2 (Catalog #AAA1276686) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgagagg tgcgggcgcg gctggcggcc acgcaggttg aatatatttc aggaaaggtt tttttcacca cctgttctga tttgaatatg ttgaagaaat taaaatctgc agaaagatta tttttgctga ttaaaaagca gtttccactt attatttctt ctgtaagtaa aggaaaaata tttaatgaaa tgcaaagact tataaatgaa gatccaggaa gttggttgaa tgccatttca atttggaaaa atcttcttga acttgatgca aaaaaggaaa aactttctca gagagatgat aaccaactaa aaagaaaagt gggagaaaat gaaatcattg caaagaaatt aaaaatagaa caaatgcaaa agatagaaga gaatagggac tgccagctgg aaaaacaaat aaaagaagaa actctggagc aaagagattt taccactaaa agcgaaaagt ttcaagaaga agaatttcag aatgacatag agaaagcaat tgatactcat aatcagaatg acttgacttt cagagtatct tgtcgctgca gtggaactat tggaaaggcc ttcactgcac aggaggtagg aaaagtaatt ggaattgcta ttatgaaaca ctttggatgg aaagcagact tgaggaatcc acaattagag atctttatac atctaaatga catttactct gtggtgggga ttcctgtgtt cagggtttcc ctagccagca gagcttacat caagacagct ggactgcgat ctacaatagc gtgggcaatg gcatctctgg ctgacattaa ggctggtgca tttgttttag atccaatgtg tggacttgga acaatacttt tggaagctgc taaagaatgg ccagatgtgt attatgtagg tgctgatgtc agcgactcac agttactagg tacttgggac aatctgaaag ctgcaggcct tgaggataaa attgaattac ttaaaatctc tgttatagaa ttgccattgc cttcagaaag tgttgatatt attatttctg acattccatt tgggaaaaag tttaagttag gaaaagacat caaaagcatt ctacaagaaa tggaaagagt gcttcatgtt ggcggaacca ttgtattgtt gcttagtgaa gatcaccaca ggcgccttac agattgtaaa gagagcaaca tccctttcaa ttccaaggac agtcacacag atgaacctgg aattaaaaag tgcttgaatc ctgaagaaaa aactggtgca ttcaagacag cgtcaacttc attcgaagcc agtaaccaca aattcttaga cagaatgtca ccatttggct ccttggtacc agtggaatgc tacaaagtta gccttggaaa gacagatgcg ttcatatgta aatataagaa gtcgcactct tctggactgt ag. It is sometimes possible for the material contained within the vial of "THUMPD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
