Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NDUFA12 cdna clone

NDUFA12 cDNA Clone

Gene Names
NDUFA12; B17.2; DAP13
Synonyms
NDUFA12; NDUFA12 cDNA Clone; NDUFA12 cdna clone
Ordering
For Research Use Only!
Sequence
atggagttagtgcaggtcctgaaacgcgggctgcagcagatcaccggccacggcggtctccgaggctatctacgggtttttttcaggacaaatgatgcgaaggttggtacattagtgggggaagacaaatatggaaacaaatactatgaagacaacaagcaattttttggccgtcaccgatgggttgtatatactactgaaatgaatggcaaaaacacattctgggatgtggatggaagcatggtgcctcctgaatggcatcgttggcttcacagtatgactgatgatcctccaacaacaaaaccacttgctgctcgtaaattcatttggacgaaccataaattcaacgtgactggcaccccagaacaatatgtaccttattctaccactagaaagaagattcaggagtggatcccaccttcaacaccttacaagtaa
Sequence Length
438
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
7,173 Da
NCBI Official Full Name
Homo sapiens NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12, mRNA
NCBI Official Synonym Full Names
NADH:ubiquinone oxidoreductase subunit A12
NCBI Official Symbol
NDUFA12
NCBI Official Synonym Symbols
B17.2; DAP13
NCBI Protein Information
NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 12
UniProt Protein Name
NADH dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 12
Protein Family
UniProt Gene Name
NDUFA12
UniProt Synonym Gene Names
DAP13; CI-B17.2; CIB17.2
UniProt Entry Name
NDUAC_HUMAN

NCBI Description

This gene encodes a protein which is part of mitochondrial complex 1, part of the oxidative phosphorylation system in mitochondria. Complex 1 transfers electrons to ubiquinone from NADH which establishes a proton gradient for the generation of ATP. Mutations in this gene are associated with Leigh syndrome due to mitochondrial complex 1 deficiency. Pseudogenes of this gene are located on chromosomes 5 and 13. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]

Uniprot Description

NDUFA12: Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I), that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone. Defects in NDUFA12 are the cause of Leigh syndrome (LS). An early-onset progressive neurodegenerative disorder characterized by the presence of focal, bilateral lesions in one or more areas of the central nervous system including the brainstem, thalamus, basal ganglia, cerebellum and spinal cord. Clinical features depend on which areas of the central nervous system are involved and include subacute onset of psychomotor retardation, hypotonia, ataxia, weakness, vision loss, eye movement abnormalities, seizures, and dysphagia. Belongs to the complex I NDUFA12 subunit family.

Protein type: Oxidoreductase; EC 1.6.99.3; Mitochondrial; EC 1.6.5.3

Chromosomal Location of Human Ortholog: 12q22

Cellular Component: mitochondrial inner membrane; mitochondrial respiratory chain complex I

Biological Process: mitochondrial electron transport, NADH to ubiquinone; mitochondrial respiratory chain complex I assembly; response to oxidative stress

Disease: Leigh Syndrome

Research Articles on NDUFA12

Similar Products

Product Notes

The NDUFA12 ndufa12 (Catalog #AAA1276634) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagttag tgcaggtcct gaaacgcggg ctgcagcaga tcaccggcca cggcggtctc cgaggctatc tacgggtttt tttcaggaca aatgatgcga aggttggtac attagtgggg gaagacaaat atggaaacaa atactatgaa gacaacaagc aattttttgg ccgtcaccga tgggttgtat atactactga aatgaatggc aaaaacacat tctgggatgt ggatggaagc atggtgcctc ctgaatggca tcgttggctt cacagtatga ctgatgatcc tccaacaaca aaaccacttg ctgctcgtaa attcatttgg acgaaccata aattcaacgt gactggcacc ccagaacaat atgtacctta ttctaccact agaaagaaga ttcaggagtg gatcccacct tcaacacctt acaagtaa. It is sometimes possible for the material contained within the vial of "NDUFA12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.