PSMB4 cdna clone
PSMB4 cDNA Clone
Synonyms
PSMB4; PSMB4 cDNA Clone; PSMB4 cdna clone
Sequence
atggaagcgtttttggggtcgcggtccggactctgggcggggggtccggccccaggacagttttaccgcattccgtccactcccgattccttcatggatccggcgtctgcactttacagaggtccaatcacgcggacccagaaccccatggtgaccgggacctcagtcctcggcgttaagttcgagggcggagtggtgattgccgcagacatgctgggatcctacggctccttggctcgtttccgcaacatctctcgcattatgcgagtcaacaacagtaccatgctgggtgcctctggcgactacgctgatttccagtatttgaagcaagttctcggccagatggtgattgatgaggagcttctgggagatggacacagctatagtcctagagctattcattcatggctgaccagggccatgtacagccggcgctcgaagatgaaccctttgtggaacaccatggtcatcggaggctatgctgatggagagagcttcctcggttatgtggacatgcttggtgtagcctatgaagccccttcgctggccactggttatggtgcatacttggctcagcctctgctgcgagaagttctggagaagcagccagtgctaagccagaccgaggcccgcgacttagtagaacgctgcatgcgagtgctgtactaccgagatgcccgttcttacaaccggtttcaaatcgccactgtcaccgaaaaaggtgttgaaatagagggaccattgtctacagagaccaactgggatattgcccacatgatcagtggctttgaatga
Sequence Length
795
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) subunit, beta type, 4, mRNA
Protein Family
Similar Products
Product Notes
The PSMB4 (Catalog #AAA1276567) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaagcgt ttttggggtc gcggtccgga ctctgggcgg ggggtccggc cccaggacag ttttaccgca ttccgtccac tcccgattcc ttcatggatc cggcgtctgc actttacaga ggtccaatca cgcggaccca gaaccccatg gtgaccggga cctcagtcct cggcgttaag ttcgagggcg gagtggtgat tgccgcagac atgctgggat cctacggctc cttggctcgt ttccgcaaca tctctcgcat tatgcgagtc aacaacagta ccatgctggg tgcctctggc gactacgctg atttccagta tttgaagcaa gttctcggcc agatggtgat tgatgaggag cttctgggag atggacacag ctatagtcct agagctattc attcatggct gaccagggcc atgtacagcc ggcgctcgaa gatgaaccct ttgtggaaca ccatggtcat cggaggctat gctgatggag agagcttcct cggttatgtg gacatgcttg gtgtagccta tgaagcccct tcgctggcca ctggttatgg tgcatacttg gctcagcctc tgctgcgaga agttctggag aagcagccag tgctaagcca gaccgaggcc cgcgacttag tagaacgctg catgcgagtg ctgtactacc gagatgcccg ttcttacaac cggtttcaaa tcgccactgt caccgaaaaa ggtgttgaaa tagagggacc attgtctaca gagaccaact gggatattgc ccacatgatc agtggctttg aatga. It is sometimes possible for the material contained within the vial of "PSMB4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
