Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

WDFY1 cdna clone

WDFY1 cDNA Clone

Gene Names
WDFY1; WDF1; FENS-1; ZFYVE17
Synonyms
WDFY1; WDFY1 cDNA Clone; WDFY1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggccgaaatccactccaggccgcagagcagccgcccggtgctgctgagcaagatcgaggggcaccaggacgccgtcacggccgcgctgctcatccccaaggaggacggcgtgatcacggccagcgaggacagaaccatccgggtatggctgaaaagagacagtggtcaatactggcccagcatttaccacacaatggcctctccttgctctgctatggcttaccatcatgacagcagacggatatttgtgggccaggataatggagctgtaatggaatttcacgtttctgaagattttaataaaatgaactttatcaagacctacccagctcatcagaaccgggtgtctgcgattatcttcagcttggccacagagtgggtgatcagtaccggccacgacaagtgtgtgagctggatgtgcacgcggagcgggaacatgctcgggaggcacttcttcacgtcctgggcttcgtgtctgcaatatgactttgacactcagtatgctttcgttggtgattattctgggcagatcaccctgctgaagcttgaacagaacacgtgttcagtcatcacaaccctcaaaggacatgaaggtagtgtcgcctgcctctggtgggaccctattcagcggttactcttctcaggagcatctgacaacagcatcatcatgtgggacatcggaggaaggaaaggccggacgctgttacttcagggccatcatgacaaggtgcagtcgctgtgctaccttcagctcaccaggcagctcgtctcctgttcctcggacggcggaattgcagtgtggaacatggatgttagcagagaagaggctcctcagtggttggaaagtgattcttgtcagaaatgtgagcagccatttttctggaacataaagcagatgtgggacaccaagacgctggggctaagacaacatcactgcaggaaatgcgggcaggctgtctgcgggaagtgcagcagcaagcgctcaagttacccagtcatgggcttcgagttccaagtccgggtttgtgattcttgttacgactccatcaaagatgaagatcggacttctctagcgacctttcatgaaggaaaacataacatttcccacatgtccatggacattgccaggggactgatggtgacctgtgggaccgaccgcattgtaaagatctgggacatgacacctgtggtgggctgcagtctggcgactgggttttctccgcactga
Sequence Length
1233
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,324 Da
NCBI Official Full Name
Homo sapiens WD repeat and FYVE domain containing 1, mRNA
NCBI Official Synonym Full Names
WD repeat and FYVE domain containing 1
NCBI Official Symbol
WDFY1
NCBI Official Synonym Symbols
WDF1; FENS-1; ZFYVE17
NCBI Protein Information
WD repeat and FYVE domain-containing protein 1
UniProt Protein Name
WD repeat and FYVE domain-containing protein 1
UniProt Gene Name
WDFY1
UniProt Synonym Gene Names
KIAA1435; WDF1; ZFYVE17
UniProt Entry Name
WDFY1_HUMAN

NCBI Description

The protein encoded by this gene is a phosphatidylinositol 3-phosphate binding protein, which contains a FYVE zinc finger domain and multiple WD-40 repeat domains. When exogenously expressed, it localizes to early endosomes. Mutagenesis analysis demonstrates that this endosomal localization is mediated by the FYVE domain. [provided by RefSeq, Jan 2015]

Uniprot Description

WDFY1: Binds PtdIns3P in vitro with high specificity over other phosphoinositides.

Chromosomal Location of Human Ortholog: 2q36.1

Cellular Component: cytosol; early endosome; nucleus

Molecular Function: phosphatidylinositol binding; protein binding

Biological Process: positive regulation of toll-like receptor 3 signaling pathway; positive regulation of toll-like receptor 4 signaling pathway

Research Articles on WDFY1

Similar Products

Product Notes

The WDFY1 wdfy1 (Catalog #AAA1276555) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggccg aaatccactc caggccgcag agcagccgcc cggtgctgct gagcaagatc gaggggcacc aggacgccgt cacggccgcg ctgctcatcc ccaaggagga cggcgtgatc acggccagcg aggacagaac catccgggta tggctgaaaa gagacagtgg tcaatactgg cccagcattt accacacaat ggcctctcct tgctctgcta tggcttacca tcatgacagc agacggatat ttgtgggcca ggataatgga gctgtaatgg aatttcacgt ttctgaagat tttaataaaa tgaactttat caagacctac ccagctcatc agaaccgggt gtctgcgatt atcttcagct tggccacaga gtgggtgatc agtaccggcc acgacaagtg tgtgagctgg atgtgcacgc ggagcgggaa catgctcggg aggcacttct tcacgtcctg ggcttcgtgt ctgcaatatg actttgacac tcagtatgct ttcgttggtg attattctgg gcagatcacc ctgctgaagc ttgaacagaa cacgtgttca gtcatcacaa ccctcaaagg acatgaaggt agtgtcgcct gcctctggtg ggaccctatt cagcggttac tcttctcagg agcatctgac aacagcatca tcatgtggga catcggagga aggaaaggcc ggacgctgtt acttcagggc catcatgaca aggtgcagtc gctgtgctac cttcagctca ccaggcagct cgtctcctgt tcctcggacg gcggaattgc agtgtggaac atggatgtta gcagagaaga ggctcctcag tggttggaaa gtgattcttg tcagaaatgt gagcagccat ttttctggaa cataaagcag atgtgggaca ccaagacgct ggggctaaga caacatcact gcaggaaatg cgggcaggct gtctgcggga agtgcagcag caagcgctca agttacccag tcatgggctt cgagttccaa gtccgggttt gtgattcttg ttacgactcc atcaaagatg aagatcggac ttctctagcg acctttcatg aaggaaaaca taacatttcc cacatgtcca tggacattgc caggggactg atggtgacct gtgggaccga ccgcattgta aagatctggg acatgacacc tgtggtgggc tgcagtctgg cgactgggtt ttctccgcac tga. It is sometimes possible for the material contained within the vial of "WDFY1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.