Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL11 cdna clone

IL11 cDNA Clone

Gene Names
IL11; AGIF; IL-11
Synonyms
IL11; IL11 cDNA Clone; IL11 cdna clone
Ordering
For Research Use Only!
Sequence
atgaactgtgtttgccgcctggtcctggtcgtgctgagcctgtggccagatacagctgtcgcccctgggccaccacctggcccccctcgagtttccccagaccctcgggccgagctggacagcaccgtgctcctgacccgctctctcctggcggacacgcggcagctggctgcacagctgagggacaaattcccagctgacggggaccacaacctggattccctgcccaccctggccatgagtgcgggggcactgggagctctacagctcccaggtgtgctgacaaggctgcgagcggacctactgtcctacctgcggcacgtgcagtggctgcgccgggcaggtggctcttccctgaagaccctggagcccgagctgggcaccctgcaggcccgactggaccggctgctgcgccggctgcagctcctgatgtcccgcctggccctgccccagccacccccggacccgccggcgcccccgctggcgcccccctcctcagcctgggggggcatcagggccgccctcgccatcctgggggggctgcacctgacacttgactgggccgtgaggggactgctgctgctgaagactcggctgtga
Sequence Length
600
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,994 Da
NCBI Official Full Name
Homo sapiens interleukin 11, mRNA
NCBI Official Synonym Full Names
interleukin 11
NCBI Official Symbol
IL11
NCBI Official Synonym Symbols
AGIF; IL-11
NCBI Protein Information
interleukin-11
UniProt Protein Name
Interleukin-11
Protein Family
UniProt Gene Name
IL11
UniProt Synonym Gene Names
AGIF
UniProt Entry Name
IL11_HUMAN

NCBI Description

The protein encoded by this gene is a member of the gp130 family of cytokines. These cytokines drive the assembly of multisubunit receptor complexes, all of which contain at least one molecule of the transmembrane signaling receptor IL6ST (gp130). This cytokine is shown to stimulate the T-cell-dependent development of immunoglobulin-producing B cells. It is also found to support the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2012]

Uniprot Description

IL11: Directly stimulates the proliferation of hematopoietic stem cells and megakaryocyte progenitor cells and induces megakaryocyte maturation resulting in increased platelet production. Belongs to the IL-6 superfamily.

Protein type: Cytokine; Secreted, signal peptide; Cell cycle regulation; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 19q13.3-q13.4

Cellular Component: cytoplasm; extracellular region

Molecular Function: cytokine activity; growth factor activity; protein binding

Biological Process: cell-cell signaling; negative regulation of hormone secretion; positive regulation of cell proliferation; positive regulation of MAPKKK cascade; positive regulation of peptidyl-serine phosphorylation; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of transcription from RNA polymerase II promoter

Research Articles on IL11

Similar Products

Product Notes

The IL11 il11 (Catalog #AAA1276505) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaactgtg tttgccgcct ggtcctggtc gtgctgagcc tgtggccaga tacagctgtc gcccctgggc caccacctgg cccccctcga gtttccccag accctcgggc cgagctggac agcaccgtgc tcctgacccg ctctctcctg gcggacacgc ggcagctggc tgcacagctg agggacaaat tcccagctga cggggaccac aacctggatt ccctgcccac cctggccatg agtgcggggg cactgggagc tctacagctc ccaggtgtgc tgacaaggct gcgagcggac ctactgtcct acctgcggca cgtgcagtgg ctgcgccggg caggtggctc ttccctgaag accctggagc ccgagctggg caccctgcag gcccgactgg accggctgct gcgccggctg cagctcctga tgtcccgcct ggccctgccc cagccacccc cggacccgcc ggcgcccccg ctggcgcccc cctcctcagc ctgggggggc atcagggccg ccctcgccat cctggggggg ctgcacctga cacttgactg ggccgtgagg ggactgctgc tgctgaagac tcggctgtga. It is sometimes possible for the material contained within the vial of "IL11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.