SSU72 cdna clone
SSU72 cDNA Clone
Gene Names
SSU72; HSPC182; PNAS-120
Synonyms
SSU72; SSU72 cDNA Clone; SSU72 cdna clone
Sequence
atgccgtcgtccccgctgcgggtggcggtggtgtgctcgagcaaccagaaccggagcatggaggcgcacaacatcctcagcaaacggggattcagcgtccgatcctttggaacagggactcacgtgaagcttccaggaccagctcccgacaagcccaatgtttatgatttcaaaaccacatatgaccagatgtacaatgatcttcttaggaaagacaaagaactctatacacagaatgggattttacatatgctggacagaaataagagaatcaagccccggccagaaagattccagaactgcaaagacctgtttgatctgatcctcacttgcgaagagagagtgtatgaccaggtggtggaagatctgaattccagagaacaggagacctgccagcccgtgcacgtggtcaatgtggacatccaggacaaccacgaggaggccaccctgggggcgtttctcatctgtgagctctgccagtgtatccagcacacggaagacatggagaacgagatcgacgagctgctgcaggagttcgaggagaagagtggccgcacctttctgcacaccgtctgcttctactga
Sequence Length
585
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
16,931 Da
NCBI Official Full Name
Homo sapiens SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SSU72 homolog, RNA polymerase II CTD phosphatase
NCBI Official Symbol
SSU72
NCBI Official Synonym Symbols
HSPC182; PNAS-120
NCBI Protein Information
RNA polymerase II subunit A C-terminal domain phosphatase SSU72
UniProt Protein Name
RNA polymerase II subunit A C-terminal domain phosphatase SSU72
Protein Family
UniProt Gene Name
SSU72
UniProt Synonym Gene Names
CTD phosphatase SSU72
UniProt Entry Name
SSU72_HUMAN
Uniprot Description
SSU72: May be involved in the C-terminal domain of RNA polymerase II dephosphorylation, RNA processing and termination. Belongs to the SSU72 phosphatase family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: EC 3.1.3.16; Phosphatase
Chromosomal Location of Human Ortholog: 1p36.33
Molecular Function: CTD phosphatase activity; protein binding
Biological Process: mRNA polyadenylation
Research Articles on SSU72
Similar Products
Product Notes
The SSU72 ssu72 (Catalog #AAA1276496) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccgtcgt ccccgctgcg ggtggcggtg gtgtgctcga gcaaccagaa ccggagcatg gaggcgcaca acatcctcag caaacgggga ttcagcgtcc gatcctttgg aacagggact cacgtgaagc ttccaggacc agctcccgac aagcccaatg tttatgattt caaaaccaca tatgaccaga tgtacaatga tcttcttagg aaagacaaag aactctatac acagaatggg attttacata tgctggacag aaataagaga atcaagcccc ggccagaaag attccagaac tgcaaagacc tgtttgatct gatcctcact tgcgaagaga gagtgtatga ccaggtggtg gaagatctga attccagaga acaggagacc tgccagcccg tgcacgtggt caatgtggac atccaggaca accacgagga ggccaccctg ggggcgtttc tcatctgtga gctctgccag tgtatccagc acacggaaga catggagaac gagatcgacg agctgctgca ggagttcgag gagaagagtg gccgcacctt tctgcacacc gtctgcttct actga. It is sometimes possible for the material contained within the vial of "SSU72, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
