Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GOLM1 cdna clone

GOLM1 cDNA Clone

Gene Names
GOLM1; GP73; HEL46; GOLPH2; C9orf155; PSEC0257; bA379P1.3
Synonyms
GOLM1; GOLM1 cDNA Clone; GOLM1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggcttgggaaacgggcgtcgcagcatgaagtcgccgcccctcgtgctggccgccctggtggcctgcatcatcgtcttgggcttcaactactggattgcgagctcccggagcgtggacctccagacacggatcatggagctggaaggcagggtccgcagggcggctgcagagagaggcgccgtggagctgaagaagaacgagttccagggagagctggagaagcagcgggagcagcttgacaaaatccagtccagccacaacttccagctggagagcgtcaacaagctgtaccaggacgaaaaggcggttttggtgaataacatcaccacaggtgagaggctcatccgagtgctgcaagaccagttaaagaccctgcagaggaattacggcaggctgcagcaggatgtcctccagtttcagaagaaccagaccaacctggagaggaagttctcctacgacctgagccagtgcatcaatcagatgaaggaggtgaaggaacagtgtgaggagcgaatagaagaggtcaccaaaaaggggaatgaagctgtagcttccagagacctgagtgaaaacaacgaccagagacagcagctccaagccctcagtgagcctcagcccaggctgcaggcagcaggcctgccacacacagaggtgccacaagggaagggaaacgtgcttggtaacagcaagtcccagacaccagcccccagttccgaagtggttttggattcaaagagacaagttgagaaagaggaaaccaatgagatccaggtggtgaatgaggagcctcagagggacaggctgccgcaggagccaggccgggagcaggtggtggaagacagacctgtaggtggaagaggcttcgggggagccggagaactgggccagaccccacaggtgcaggctgccctgtcagtgagccaggaaaatccagagatggagggccctgagcgagaccagcttgtcatccccgacggacaggaggaggagcaggaagctgccggggaagggagaaaccagcagaaactgagaggagaagatgactacaacatggatgaaaatgaagcagaatctgagacagacaagcaagcagccctggcagggaatgacagaaacatagatgtttttaatgttgaagatcagaaaagagacaccataaatttacttgatcagcgtgaaaagcggaatcatacactctga
Sequence Length
1203
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,273 Da
NCBI Official Full Name
Homo sapiens golgi membrane protein 1, mRNA
NCBI Official Synonym Full Names
golgi membrane protein 1
NCBI Official Symbol
GOLM1
NCBI Official Synonym Symbols
GP73; HEL46; GOLPH2; C9orf155; PSEC0257; bA379P1.3
NCBI Protein Information
Golgi membrane protein 1
UniProt Protein Name
Golgi membrane protein 1
Protein Family
UniProt Gene Name
GOLM1
UniProt Synonym Gene Names
C9orf155; GOLPH2
UniProt Entry Name
GOLM1_HUMAN

NCBI Description

The Golgi complex plays a key role in the sorting and modification of proteins exported from the endoplasmic reticulum. The protein encoded by this gene is a type II Golgi transmembrane protein. It processes proteins synthesized in the rough endoplasmic reticulum and assists in the transport of protein cargo through the Golgi apparatus. The expression of this gene has been observed to be upregulated in response to viral infection. Alternatively spliced transcript variants encoding the same protein have been described for this gene. [provided by RefSeq, Sep 2009]

Uniprot Description

GOLM1: Unknown. Cellular response protein to viral infection. Belongs to the GOLM1/CASC4 family. 2 isoforms of the human protein are produced by alternative initiation.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 9q21.33

Cellular Component: extracellular space; integral to plasma membrane

Molecular Function: protein binding

Research Articles on GOLM1

Similar Products

Product Notes

The GOLM1 golm1 (Catalog #AAA1276483) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggcttgg gaaacgggcg tcgcagcatg aagtcgccgc ccctcgtgct ggccgccctg gtggcctgca tcatcgtctt gggcttcaac tactggattg cgagctcccg gagcgtggac ctccagacac ggatcatgga gctggaaggc agggtccgca gggcggctgc agagagaggc gccgtggagc tgaagaagaa cgagttccag ggagagctgg agaagcagcg ggagcagctt gacaaaatcc agtccagcca caacttccag ctggagagcg tcaacaagct gtaccaggac gaaaaggcgg ttttggtgaa taacatcacc acaggtgaga ggctcatccg agtgctgcaa gaccagttaa agaccctgca gaggaattac ggcaggctgc agcaggatgt cctccagttt cagaagaacc agaccaacct ggagaggaag ttctcctacg acctgagcca gtgcatcaat cagatgaagg aggtgaagga acagtgtgag gagcgaatag aagaggtcac caaaaagggg aatgaagctg tagcttccag agacctgagt gaaaacaacg accagagaca gcagctccaa gccctcagtg agcctcagcc caggctgcag gcagcaggcc tgccacacac agaggtgcca caagggaagg gaaacgtgct tggtaacagc aagtcccaga caccagcccc cagttccgaa gtggttttgg attcaaagag acaagttgag aaagaggaaa ccaatgagat ccaggtggtg aatgaggagc ctcagaggga caggctgccg caggagccag gccgggagca ggtggtggaa gacagacctg taggtggaag aggcttcggg ggagccggag aactgggcca gaccccacag gtgcaggctg ccctgtcagt gagccaggaa aatccagaga tggagggccc tgagcgagac cagcttgtca tccccgacgg acaggaggag gagcaggaag ctgccgggga agggagaaac cagcagaaac tgagaggaga agatgactac aacatggatg aaaatgaagc agaatctgag acagacaagc aagcagccct ggcagggaat gacagaaaca tagatgtttt taatgttgaa gatcagaaaa gagacaccat aaatttactt gatcagcgtg aaaagcggaa tcatacactc tga. It is sometimes possible for the material contained within the vial of "GOLM1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.