Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IRAK1 cdna clone

IRAK1 cDNA Clone

Gene Names
IRAK1; IRAK; pelle
Synonyms
IRAK1; IRAK1 cDNA Clone; IRAK1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccggggggccgggcccgggggagcccgcagcccccggcgcccagcacttcttgtacgaggtgccgccctgggtcatgtgccgcttctacaaagtgatggacgccctggagcccgccgactggtgccagttcgccgccctgatcgtgcgcgaccagaccgagctgcggctgtgcgagcgctccgggcagcgcacggccagcgtcctgtggccctggatcaaccgcaacgcccgtgtggccgacctcgtgcacatcctcacgcacctgcagctgctccgtgcgcgggacatcatcacagcctggcaccctcccgccccgcttccgtccccaggcaccactgccccgaggcccagcagcatccctgcacccgccgaggccgaggcctggagcccccggaagttgccatcctcagcctccaccttcctctccccagcttttccaggctcccagacccattcagggcctgagctcggcctggttccaagccctgcttccctgtggcctccaccgccatctccagccccttcttctaccaagccaggcccagagagctcagtgtccctcctgcagggagcccgcccctctccgttttgctggcccctctgtgagatttcccggggcacccacaacttctcggaggagctcaagatcggggagggtggctttgggtgcgtgtaccgggcggtgatgaggaacacggtgtatgctgtgaagaggctgaaggagaacgctgacctggagtggactgcagtgaagcagagcttcctgaccgaggtggagcagctgtccaggtttcgtcacccaaacattgtggactttgctggctactgtgctcagaacggcttctactgcctggtgtacggcttcctgcccaacggctccctggaggaccgtctccactgccagacccaggcctgcccacctctctcctggcctcagcgactggacatccttctgggtacagcccgggcaattcagtttctacatcaggacagccccagcctcatccatggagacatcaagagttccaacgtccttctggatgagaggctgacacccaagctgggagactttggcctggcccggttcagccgctttgccgggtccagccccagccagagcagcatggtggcccggacacagacagtgcggggcaccctggcctacctgcccgaggagtacatcaagacgggaaggctggctgtggacacggacaccttcagctttggggtggtagtgctagagaccttggctggtcagagggctgtgaagacgcacggtgccaggaccaagtatctggtgtacgagaggctagagaagctgcaggcagtggtggcgggggtgcccgggcatttggaggccgccagctgcatccccccttccccgcaggagaactcctacgtgtccagcactggcagagcccacagtggggctgctccatggcagcccctggcagcgccatcaggagccagtgcccaggcagcagagcagctgcagagaggccccaaccagcccgtggagagtgacgagagcctaggcggcctctctgctgccctgcgctcctggcacttgactccaagctgccctctggacccagcacccctcagggaggccggctgtcctcagggggacacggcaggagaatcgagctgggggagtggcccaggatcccggcccacagccgtggaaggactggcccttggcagctctgcatcatcgtcgtcagagccaccgcagattatcatcaaccctgcccgacagaagatggtccagaagctggccctgtacgaggatggggccctggacagcctgcagctgctgtcgtccagctccctcccaggcttgggcctggaacaggacaggcaggggcccgaagaaagtgatgaatttcagagctga
Sequence Length
1902
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
68,022 Da
NCBI Official Full Name
Homo sapiens interleukin-1 receptor-associated kinase 1, mRNA
NCBI Official Synonym Full Names
interleukin 1 receptor associated kinase 1
NCBI Official Symbol
IRAK1
NCBI Official Synonym Symbols
IRAK; pelle
NCBI Protein Information
interleukin-1 receptor-associated kinase 1
UniProt Protein Name
Interleukin-1 receptor-associated kinase 1
UniProt Gene Name
IRAK1
UniProt Synonym Gene Names
IRAK; IRAK-1
UniProt Entry Name
IRAK1_HUMAN

NCBI Description

This gene encodes the interleukin-1 receptor-associated kinase 1, one of two putative serine/threonine kinases that become associated with the interleukin-1 receptor (IL1R) upon stimulation. This gene is partially responsible for IL1-induced upregulation of the transcription factor NF-kappa B. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

IRAK1: a TKL kinase of the IRAK family. Involved in Toll/IL-1 signaling. One of two putative serine/threonine kinases that become associated with the interleukin-1 receptor following IL-1 engagement, triggering intracellular signaling cascades leading to transcriptional up-regulation and mRNA stabilization. Extensively phosphorylated after its association with IL1-R-1. Polyubiquitinated; after cell stimulation with IL-1-beta. Polyubiquitination occurs with polyubiquitin chains linked through 'Lys-63'. Partially responsible for IL1-induced upregulation of the transcription factor NF-kappa B. Three isoforms of the human protein and produced by alternative splicing. Isoform 1 binds rapidly but is then degraded allowing isoform 2 to mediate a slower, more sustained response to the cytokine. Isoform 2 is inactive suggesting that the kinase activity of this enzyme is not required for IL-1 signaling. Once phosphorylated, IRAK1 recruits the adapter protein PELI1. Isoform 1 and isoform 2 are ubiquitously expressed in all tissues examined, with isoform 1 being more strongly expressed than isoform 2.

Protein type: Protein kinase, Ser/Thr (non-receptor); Protein kinase, TKL; EC 2.7.11.1; Kinase, protein; TKL group; IRAK family

Chromosomal Location of Human Ortholog: Xq28

Cellular Component: cytoplasm; cytosol; endosome membrane; lipid particle; nucleus; plasma membrane

Molecular Function: kinase activity; NF-kappaB-inducing kinase activity; protein binding; protein heterodimerization activity; protein homodimerization activity; protein kinase activity; protein serine/threonine kinase activity

Biological Process: activation of MAPK activity; activation of NF-kappaB transcription factor; activation of NF-kappaB-inducing kinase; inhibition of NF-kappaB transcription factor; JNK cascade; lipopolysaccharide-mediated signaling pathway; MyD88-dependent toll-like receptor signaling pathway; negative regulation of apoptosis; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interferon type I production; positive regulation of MAP kinase activity; protein amino acid autophosphorylation; protein amino acid phosphorylation; protein oligomerization; regulation of cytokine and chemokine mediated signaling pathway; response to lipopolysaccharide; toll-like receptor 2 signaling pathway; toll-like receptor 4 signaling pathway; toll-like receptor 9 signaling pathway; toll-like receptor signaling pathway

Research Articles on IRAK1

Similar Products

Product Notes

The IRAK1 irak1 (Catalog #AAA1276293) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgggg ggccgggccc gggggagccc gcagcccccg gcgcccagca cttcttgtac gaggtgccgc cctgggtcat gtgccgcttc tacaaagtga tggacgccct ggagcccgcc gactggtgcc agttcgccgc cctgatcgtg cgcgaccaga ccgagctgcg gctgtgcgag cgctccgggc agcgcacggc cagcgtcctg tggccctgga tcaaccgcaa cgcccgtgtg gccgacctcg tgcacatcct cacgcacctg cagctgctcc gtgcgcggga catcatcaca gcctggcacc ctcccgcccc gcttccgtcc ccaggcacca ctgccccgag gcccagcagc atccctgcac ccgccgaggc cgaggcctgg agcccccgga agttgccatc ctcagcctcc accttcctct ccccagcttt tccaggctcc cagacccatt cagggcctga gctcggcctg gttccaagcc ctgcttccct gtggcctcca ccgccatctc cagccccttc ttctaccaag ccaggcccag agagctcagt gtccctcctg cagggagccc gcccctctcc gttttgctgg cccctctgtg agatttcccg gggcacccac aacttctcgg aggagctcaa gatcggggag ggtggctttg ggtgcgtgta ccgggcggtg atgaggaaca cggtgtatgc tgtgaagagg ctgaaggaga acgctgacct ggagtggact gcagtgaagc agagcttcct gaccgaggtg gagcagctgt ccaggtttcg tcacccaaac attgtggact ttgctggcta ctgtgctcag aacggcttct actgcctggt gtacggcttc ctgcccaacg gctccctgga ggaccgtctc cactgccaga cccaggcctg cccacctctc tcctggcctc agcgactgga catccttctg ggtacagccc gggcaattca gtttctacat caggacagcc ccagcctcat ccatggagac atcaagagtt ccaacgtcct tctggatgag aggctgacac ccaagctggg agactttggc ctggcccggt tcagccgctt tgccgggtcc agccccagcc agagcagcat ggtggcccgg acacagacag tgcggggcac cctggcctac ctgcccgagg agtacatcaa gacgggaagg ctggctgtgg acacggacac cttcagcttt ggggtggtag tgctagagac cttggctggt cagagggctg tgaagacgca cggtgccagg accaagtatc tggtgtacga gaggctagag aagctgcagg cagtggtggc gggggtgccc gggcatttgg aggccgccag ctgcatcccc ccttccccgc aggagaactc ctacgtgtcc agcactggca gagcccacag tggggctgct ccatggcagc ccctggcagc gccatcagga gccagtgccc aggcagcaga gcagctgcag agaggcccca accagcccgt ggagagtgac gagagcctag gcggcctctc tgctgccctg cgctcctggc acttgactcc aagctgccct ctggacccag cacccctcag ggaggccggc tgtcctcagg gggacacggc aggagaatcg agctggggga gtggcccagg atcccggccc acagccgtgg aaggactggc ccttggcagc tctgcatcat cgtcgtcaga gccaccgcag attatcatca accctgcccg acagaagatg gtccagaagc tggccctgta cgaggatggg gccctggaca gcctgcagct gctgtcgtcc agctccctcc caggcttggg cctggaacag gacaggcagg ggcccgaaga aagtgatgaa tttcagagct ga. It is sometimes possible for the material contained within the vial of "IRAK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.