PCNXL2 cdna clone
PCNXL2 cDNA Clone
Gene Names
PCNX2; PCNXL2
Synonyms
PCNXL2; PCNXL2 cDNA Clone; PCNXL2 cdna clone
Sequence
atgctgttttttggtggttctgctgtgtctgggataacctcggctgtttacagtgtggcccggagcgtcttggctgccgccctgctccacgcagtctgcttcagtgcagtgaaggaaccgtggagcatgcaacacatcccggcactgttttcggccttctgtggcctcttggtcgccctttcttaccatctgagccgtcagagcagtgacccatctgtactcatgtccttcatccaatgcaggctgtttcctaaatttttacatcaaaatctggcagagtcagctgctgaccctctccccaagaagatgaaagattcagtgacggatgtcttaaaatgggatctcatcgtctgcgcagtggttgctgtcctctcatttgcagtcagcgccagcactgtattcctgtcattgcgaccatttctcagcatcgtgctgtttgccttggctggagccgtggggtttgtaacacattacgtgctccctcagctccgcaagcatcatccctggatgtggatttcacaccccattctcaaaaacaaagagtatcatcaacgggaagtgagagatgttgcccatttaatgtggttcgaaagactctatgtttggcttcagtgttttgaaaaatacatcttgtacccagcgctaattttgaatgccctcactattgatgcatttttaataagcaatcaccggagacttggtacccactgggacatttttctgatgatcattgctggcatgaagctgttgcggacatcattctgcaacccggtttaccagtttattaacttgagcttcactgtcatctttttccactttgactacaaagatatttcagagagcttcttactggatttcttcatggtgtccattttatttagcaaggtgtttctgggctacgtgaggcaaaaataa
Sequence Length
915
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
75,024 Da
NCBI Official Full Name
Homo sapiens pecanex-like 2 (Drosophila), mRNA
NCBI Official Synonym Full Names
pecanex homolog 2 (Drosophila)
NCBI Official Symbol
PCNX2
NCBI Official Synonym Symbols
PCNXL2
NCBI Protein Information
pecanex-like protein 2
UniProt Protein Name
Pecanex-like protein 2
UniProt Gene Name
PCNX2
UniProt Entry Name
PCX2_HUMAN
NCBI Description
This gene contains coding mononucleotide repeats that are associated with tumors of high mcrosatellite instability (MSI-H). Defects in this gene are involved in the tumorigenesis of MSI-H colorectal carcinomas. [provided by RefSeq, Jun 2016]
Uniprot Description
PCNXL2: May play a role in tumorigenesis of colorectal carcinomas with high microsatellite instability (MSI-H). Belongs to the pecanex family. 5 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Membrane protein, integral
Chromosomal Location of Human Ortholog: 1q42.2
Research Articles on PCNXL2
Similar Products
Product Notes
The PCNXL2 pcnx2 (Catalog #AAA1276284) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgtttt ttggtggttc tgctgtgtct gggataacct cggctgttta cagtgtggcc cggagcgtct tggctgccgc cctgctccac gcagtctgct tcagtgcagt gaaggaaccg tggagcatgc aacacatccc ggcactgttt tcggccttct gtggcctctt ggtcgccctt tcttaccatc tgagccgtca gagcagtgac ccatctgtac tcatgtcctt catccaatgc aggctgtttc ctaaattttt acatcaaaat ctggcagagt cagctgctga ccctctcccc aagaagatga aagattcagt gacggatgtc ttaaaatggg atctcatcgt ctgcgcagtg gttgctgtcc tctcatttgc agtcagcgcc agcactgtat tcctgtcatt gcgaccattt ctcagcatcg tgctgtttgc cttggctgga gccgtggggt ttgtaacaca ttacgtgctc cctcagctcc gcaagcatca tccctggatg tggatttcac accccattct caaaaacaaa gagtatcatc aacgggaagt gagagatgtt gcccatttaa tgtggttcga aagactctat gtttggcttc agtgttttga aaaatacatc ttgtacccag cgctaatttt gaatgccctc actattgatg catttttaat aagcaatcac cggagacttg gtacccactg ggacattttt ctgatgatca ttgctggcat gaagctgttg cggacatcat tctgcaaccc ggtttaccag tttattaact tgagcttcac tgtcatcttt ttccactttg actacaaaga tatttcagag agcttcttac tggatttctt catggtgtcc attttattta gcaaggtgtt tctgggctac gtgaggcaaa aataa. It is sometimes possible for the material contained within the vial of "PCNXL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
