Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL32 cdna clone

IL32 cDNA Clone

Gene Names
IL32; NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd; IL-32beta; IL-32alpha; IL-32delta; IL-32gamma
Synonyms
IL32; IL32 cDNA Clone; IL32 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgcttcccgaaggtcctctctgatgacatgaagaagctgaaggcccgaatggtaatgctcctccctacttctgctcaggggttgggggcctgggtctcagcgtgtgacactgaggacactgtgggacacctgggaccctggagggacaaggatccggccctttggtgccaactctgcctctcttcacagcaccaggccatagaaagattttatgataaaatgcaaaatgcagaatcaggacgtggacaggtgatgtcgagcctggcagagctggaggacgacttcaaagagggctacctggagacagtggcggcttattatgaggagcagcacccagagctcactcctctacttgaaaaagaaagagatggattacggtgccgaggcaacagatcccctgtcccggatgttgaggatcccgcaaccgaggagcctggggagagcttttgtgacaaggtcatgagatggttccaggccatgctgcagcggctgcagacctggtggcacggggttctggcctgggtgaaggagaaggtggtggccctggtccatgcagtgcaggccctctggaaacagttccagagtttctgctgctctctgtcagagctcttcatgtcctctttccagtcctacggagccccacggggggacaaggaggagctgacaccccagaagtgctctgaaccccaatcctcaaaatga
Sequence Length
705
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,003 Da
NCBI Official Full Name
Homo sapiens interleukin 32, mRNA
NCBI Official Synonym Full Names
interleukin 32
NCBI Official Symbol
IL32
NCBI Official Synonym Symbols
NK4; TAIF; TAIFa; TAIFb; TAIFc; TAIFd; IL-32beta; IL-32alpha; IL-32delta; IL-32gamma
NCBI Protein Information
interleukin-32
UniProt Protein Name
Interleukin-32
Protein Family
UniProt Gene Name
IL32
UniProt Synonym Gene Names
NK4; TAIF; IL-32
UniProt Entry Name
IL32_HUMAN

NCBI Description

This gene encodes a member of the cytokine family. The protein contains a tyrosine sulfation site, 3 potential N-myristoylation sites, multiple putative phosphorylation sites, and an RGD cell-attachment sequence. Expression of this protein is increased after the activation of T-cells by mitogens or the activation of NK cells by IL-2. This protein induces the production of TNFalpha from macrophage cells. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

IL32: Cytokine that may play a role in innate and adaptive immune responses. It induces various cytokines such as TNFA/TNF- alpha and IL8. It activates typical cytokine signal pathways of NF-kappa-B and p38 MAPK. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Secreted; Cell adhesion

Chromosomal Location of Human Ortholog: 16p13.3

Cellular Component: cytosol; membrane

Molecular Function: protein binding

Biological Process: cell adhesion; defense response

Research Articles on IL32

Similar Products

Product Notes

The IL32 il32 (Catalog #AAA1276278) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgcttcc cgaaggtcct ctctgatgac atgaagaagc tgaaggcccg aatggtaatg ctcctcccta cttctgctca ggggttgggg gcctgggtct cagcgtgtga cactgaggac actgtgggac acctgggacc ctggagggac aaggatccgg ccctttggtg ccaactctgc ctctcttcac agcaccaggc catagaaaga ttttatgata aaatgcaaaa tgcagaatca ggacgtggac aggtgatgtc gagcctggca gagctggagg acgacttcaa agagggctac ctggagacag tggcggctta ttatgaggag cagcacccag agctcactcc tctacttgaa aaagaaagag atggattacg gtgccgaggc aacagatccc ctgtcccgga tgttgaggat cccgcaaccg aggagcctgg ggagagcttt tgtgacaagg tcatgagatg gttccaggcc atgctgcagc ggctgcagac ctggtggcac ggggttctgg cctgggtgaa ggagaaggtg gtggccctgg tccatgcagt gcaggccctc tggaaacagt tccagagttt ctgctgctct ctgtcagagc tcttcatgtc ctctttccag tcctacggag ccccacgggg ggacaaggag gagctgacac cccagaagtg ctctgaaccc caatcctcaa aatga. It is sometimes possible for the material contained within the vial of "IL32, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.