Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MIA2 cdna clone

MIA2 cDNA Clone

Synonyms
MIA2; MIA2 cDNA Clone; MIA2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaaaatttggcgttcacagaatccttcttctggctatttctctgacaaagtgtctggagagtacaaaactgctggcagaccttaaaaaatgtggtgacttggaatgtgaagctttaataaacagagtctcagccatgagagattatagaggacctgactgccgatacctgaacttcactaagggagaagagatatctgtttatgttaaacttgcaggagaaagggaagatttgtgggcaggaagtaaaggaaaggagtttggatattttcccagagatgcagtccagattgaagaggtgttcatatctgaggaaattcagatgtcaacgaaagaatctgactttctttgtcttcttggagtaagttacacatttgacaatgaagatagtgaattaaacggtgattatggtgaaaatatatatccttatgaagaagataaagatgaaaaatctagtatatatgaaagtgattttcagatagaacctggattttatgcaacttatgaaagtactttgtttgaagaccaagttccagcattagaggctcctgaagatatcggaagtaccagtgaatcaaaagactgggaagaagtagttgttgaaagtatggaacaggatcgtattccagaagtgcatgtcccaccatcttcagctgtgtctggagtcaaagaatggtttggattgggaggagaacaagctgaagagaaggcttttgaatcagttattgaacctgtacaagaaagctcatttcggagtagaaaaatagcagtggaagatgagaatgacctagaggaattaaataatggtgagcctcaaacagaacatcagcaagaatctgaatcagaaattgattcagtgccaaagacacagtctgaactagcatctgagtcagagcacattcccaaacctcaatccactggttggtttggtggaggatttacaagttatttaggttttggagatgaggatacagggcttgaattaatagctgaagaaagcaatccaccactacaagattttcccaattccatatcatctgataaagaagccacagttccatgtacagaaatattaacagaaaaaaaagacacaatcactaatgatagcttgagtctcaagccaagttggtttgattttggttttgctatactaggctttgcatatgccaaggaagataaaattatgttagatgacaggaaaaatgaagaagatggtggggcagatgaacatgaacatcctctaacaagtgaattagaccctgaaaaagaacaagaaatagaaacgataaaaattatagaaacagaagatcaaatagacaagaaaccagtctcagaaaaaacagacgaatctgatactataccatatttgaaaaagttcttgtataattttgacaacccttggaacttccagaacattccaaaggaaacagaattgccatttcccaaacagatactggatcaaaataatgtaattgaaaatgaagaaactggagaattttccattgataattatcccacagataatacaaaagttatgatattcaaaagttcatacagtctgtcagatatggtctctaacatagagttacctacgagaattcacgaagaagtatattttgaaccctcatcttctaaagatagtgatgaaaattcgaaaccatcagtagacaccgaagggcctgctctggtggagatagacagatctgtggaaaataccctgctaaatagtcagatggtttcaactgataactctttgtcttctcaaaattatatttctcagaaagaagatgcttctgagtttcagattctgaaatacttattccaaattgatgtttatgatttcatgaattctgcattttcaccaattgtaattcttacagaaagggtaagtttgccttttaaaccttttgcaataattttacctattttgctaaatataagagtggctacaaaatatgtttga
Sequence Length
1965
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,089 Da
NCBI Official Full Name
Homo sapiens melanoma inhibitory activity 2, mRNA
NCBI Official Synonym Full Names
melanoma inhibitory activity 2
NCBI Official Symbol
MIA2
NCBI Protein Information
melanoma inhibitory activity protein 2
UniProt Protein Name
Melanoma inhibitory activity protein 2
UniProt Gene Name
MIA2
UniProt Entry Name
MIA2_HUMAN

Uniprot Description

MIA2: May play a role in the pathophysiology of liver disease and may serve as a marker of liver damage. Belongs to the MIA/OTOR family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 14q13.2

Research Articles on MIA2

Similar Products

Product Notes

The MIA2 mia2 (Catalog #AAA1276179) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaaaat ttggcgttca cagaatcctt cttctggcta tttctctgac aaagtgtctg gagagtacaa aactgctggc agaccttaaa aaatgtggtg acttggaatg tgaagcttta ataaacagag tctcagccat gagagattat agaggacctg actgccgata cctgaacttc actaagggag aagagatatc tgtttatgtt aaacttgcag gagaaaggga agatttgtgg gcaggaagta aaggaaagga gtttggatat tttcccagag atgcagtcca gattgaagag gtgttcatat ctgaggaaat tcagatgtca acgaaagaat ctgactttct ttgtcttctt ggagtaagtt acacatttga caatgaagat agtgaattaa acggtgatta tggtgaaaat atatatcctt atgaagaaga taaagatgaa aaatctagta tatatgaaag tgattttcag atagaacctg gattttatgc aacttatgaa agtactttgt ttgaagacca agttccagca ttagaggctc ctgaagatat cggaagtacc agtgaatcaa aagactggga agaagtagtt gttgaaagta tggaacagga tcgtattcca gaagtgcatg tcccaccatc ttcagctgtg tctggagtca aagaatggtt tggattggga ggagaacaag ctgaagagaa ggcttttgaa tcagttattg aacctgtaca agaaagctca tttcggagta gaaaaatagc agtggaagat gagaatgacc tagaggaatt aaataatggt gagcctcaaa cagaacatca gcaagaatct gaatcagaaa ttgattcagt gccaaagaca cagtctgaac tagcatctga gtcagagcac attcccaaac ctcaatccac tggttggttt ggtggaggat ttacaagtta tttaggtttt ggagatgagg atacagggct tgaattaata gctgaagaaa gcaatccacc actacaagat tttcccaatt ccatatcatc tgataaagaa gccacagttc catgtacaga aatattaaca gaaaaaaaag acacaatcac taatgatagc ttgagtctca agccaagttg gtttgatttt ggttttgcta tactaggctt tgcatatgcc aaggaagata aaattatgtt agatgacagg aaaaatgaag aagatggtgg ggcagatgaa catgaacatc ctctaacaag tgaattagac cctgaaaaag aacaagaaat agaaacgata aaaattatag aaacagaaga tcaaatagac aagaaaccag tctcagaaaa aacagacgaa tctgatacta taccatattt gaaaaagttc ttgtataatt ttgacaaccc ttggaacttc cagaacattc caaaggaaac agaattgcca tttcccaaac agatactgga tcaaaataat gtaattgaaa atgaagaaac tggagaattt tccattgata attatcccac agataataca aaagttatga tattcaaaag ttcatacagt ctgtcagata tggtctctaa catagagtta cctacgagaa ttcacgaaga agtatatttt gaaccctcat cttctaaaga tagtgatgaa aattcgaaac catcagtaga caccgaaggg cctgctctgg tggagataga cagatctgtg gaaaataccc tgctaaatag tcagatggtt tcaactgata actctttgtc ttctcaaaat tatatttctc agaaagaaga tgcttctgag tttcagattc tgaaatactt attccaaatt gatgtttatg atttcatgaa ttctgcattt tcaccaattg taattcttac agaaagggta agtttgcctt ttaaaccttt tgcaataatt ttacctattt tgctaaatat aagagtggct acaaaatatg tttga. It is sometimes possible for the material contained within the vial of "MIA2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.