Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRH cdna clone

TRH cDNA Clone

Gene Names
TRH; TRF; Pro-TRH
Synonyms
TRH; TRH cDNA Clone; TRH cdna clone
Ordering
For Research Use Only!
Sequence
atgcccggcccttggttgctgctcgctctggctttgaccctgaacctgaccggtgtccccggcggccgtgctcagccagaggcggcccagcaggaggcagtgacggccgcggagcatccgggcctggatgacttcctgcgccaggtggagcgcctcctcttcctccgggaaaacatccagcggctgcaaggggaccagggtgagcactccgcgtcccagatctttcaatctgactggctctccaaacgtcagcatccaggcaaaagagaggaggaggaggaagagggagttgaagaagaggaagaggaagaagggggggctgtgggaccccacaaacggcagcaccctggccgacgagaagatgaggcttcatggtcagtcgatgtaacccagcacaagcggcagcatcctggccggcgctccccctggcttgcatatgctgtcccgaagcggcagcacccaggcagaaggctggcagatcccaaggctcaaaggagctgggaagaagaggaggaggaggaagagagagaggaagacctgatgcctgaaaaacgccagcatccgggcaagagggccctgggaggcccctgtgggccccagggagcctatggtcaagcaggcctcctgctggggctcctggatgacctgagtaggagccagggagctgaggaaaagcggcagcaccctggtcggcgggcagcctgggtcagggagcccctggaggagtga
Sequence Length
729
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
27,404 Da
NCBI Official Full Name
Homo sapiens thyrotropin-releasing hormone, mRNA
NCBI Official Synonym Full Names
thyrotropin releasing hormone
NCBI Official Symbol
TRH
NCBI Official Synonym Symbols
TRF; Pro-TRH
NCBI Protein Information
thyrotropin releasing hormone
UniProt Protein Name
Pro-thyrotropin-releasing hormone
UniProt Gene Name
TRH
UniProt Synonym Gene Names
Pro-TRH; TRH; TRF
UniProt Entry Name
TRH_HUMAN

NCBI Description

This gene encodes a member of the thyrotropin-releasing hormone family. Cleavage of the encoded proprotein releases mature thyrotropin-releasing hormone, which is a tripeptide hypothalamic regulatory hormone. The human proprotein contains six thyrotropin-releasing hormone tripeptides. Thyrotropin-releasing hormone is involved in the regulation and release of thyroid-stimulating hormone, as well as prolactin. Deficiency of this hormone has been associated with hypothalamic hypothyroidism. [provided by RefSeq, May 2013]

Uniprot Description

TRH: Functions as a regulator of the biosynthesis of TSH in the anterior pituitary gland and as a neurotransmitter/ neuromodulator in the central and peripheral nervous systems. May promote hair shaft elongation, prolonge the hair cycle growth phase (anagen) and antagonized its termination by TGFB2. May also increase proliferation and inhibited apoptosis of hair matrix keratinocytes. Belongs to the TRH family.

Protein type: Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 3q13.3-q21

Cellular Component: extracellular region; nucleus; plasma membrane; secretory granule

Biological Process: cell-cell signaling; eating behavior; histamine metabolic process; negative regulation of glutamate secretion; positive regulation of gamma-aminobutyric acid secretion; positive regulation of insulin secretion; signal transduction

Disease: Thyrotropin-releasing Hormone Deficiency

Research Articles on TRH

Similar Products

Product Notes

The TRH trh (Catalog #AAA1276149) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccggcc cttggttgct gctcgctctg gctttgaccc tgaacctgac cggtgtcccc ggcggccgtg ctcagccaga ggcggcccag caggaggcag tgacggccgc ggagcatccg ggcctggatg acttcctgcg ccaggtggag cgcctcctct tcctccggga aaacatccag cggctgcaag gggaccaggg tgagcactcc gcgtcccaga tctttcaatc tgactggctc tccaaacgtc agcatccagg caaaagagag gaggaggagg aagagggagt tgaagaagag gaagaggaag aagggggggc tgtgggaccc cacaaacggc agcaccctgg ccgacgagaa gatgaggctt catggtcagt cgatgtaacc cagcacaagc ggcagcatcc tggccggcgc tccccctggc ttgcatatgc tgtcccgaag cggcagcacc caggcagaag gctggcagat cccaaggctc aaaggagctg ggaagaagag gaggaggagg aagagagaga ggaagacctg atgcctgaaa aacgccagca tccgggcaag agggccctgg gaggcccctg tgggccccag ggagcctatg gtcaagcagg cctcctgctg gggctcctgg atgacctgag taggagccag ggagctgagg aaaagcggca gcaccctggt cggcgggcag cctgggtcag ggagcccctg gaggagtga. It is sometimes possible for the material contained within the vial of "TRH, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.