Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ALPI cdna clone

ALPI cDNA Clone

Gene Names
ALPI; IAP
Synonyms
ALPI; ALPI cDNA Clone; ALPI cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggggccctgggtgctgctgctgctgggcctgaggctacagctctccctgggcgtcatcccagctgaggaggagaacccggccttctggaaccgccaggcagctgaggccctggatgctgccaagaagctgcagcccatccagaaggtcgccaagaacctcatcctcttcctgggcgatgggttgggggtgcccacggtgacagccaccaggatcctaaaggggcagaagaatggcaaactggggcctgagacgcccctggccatggaccgcttcccatacctggctctgtccaagacatacaatgtggacagacaggtgccagacagcgcagccacagccacggcctacctgtgcggggtcaaggccaacttccagaccatcggcttgagtgcagccgcccgctttaaccagtgcaacacgacacgcggcaatgaggtcatctccgtgatgaaccgggccaagcaagcaggaaagtcagtaggagtggtgaccaccacacgggtgcagcacgcctcgccagccggcacctacgcacacacagtgaaccgcaactggtactcagatgctgacatgcctgcctcagcccgccaggaggggtgccaggacatcgccactcagctcatctccaacatggacattgacgtgatccttggcggaggccgcaagtacatgtttcccatggggaccccagaccctgagtacccagctgatgccagccagaatggaatcaggctggacgggaagaacctggtgcaggaatggctggcaaagcaccagggtgcctggtatgtgtggaaccgcactgagctcatgcaggcgtccctggaccagtctgtgacccatctcatgggcctctttgagcccggagacacgaaatatgagatccaccgagaccccacactggacccctccctgatggagatgacagaggctgccctgcgcctgctgagcaggaacccccgcggcttctacctctttgtggagggcggccgcatcgaccatggtcatcatgagggtgtggcttaccaggcactcactgaggcggtcatgttcgacgacgccattgagagggcgggccagctcaccagcgaggaggacacgctgaccctcgtcaccgctgaccactcccatgtcttctcctttggtggctacaccttgcgagggagctccatcttcgggttggcccccagcaaggctcaggacagcaaagcctacacgtccatcctgtacggcaatggcccgggctacgtgttcaactcaggcgtgcgaccagacgtgaatgagagcgagagcgggagccccgattaccagcagcaggcggcggtgcccctgtcgtccgagacccacggaggcgaagacgtggcggtgtttgcgcgcggcccgcaggcgcacctggtgcatggtgtgcaggagcagagcttcgtagcgcatgtcatggccttcgctgcctgtctggagccctacacggcctgcgacctggcgcctcccgcctgcaccaccgacgccgcgcacccagttgccgcgtcgctgccactgctggccgggaccctgctgctgctgggggcgtccgctgctccctga
Sequence Length
1587
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
248
Molecular Weight
56,812 Da
NCBI Official Full Name
Homo sapiens alkaline phosphatase, intestinal, mRNA
NCBI Official Synonym Full Names
alkaline phosphatase, intestinal
NCBI Official Symbol
ALPI
NCBI Official Synonym Symbols
IAP
NCBI Protein Information
intestinal-type alkaline phosphatase
UniProt Protein Name
Intestinal-type alkaline phosphatase
UniProt Gene Name
ALPI
UniProt Synonym Gene Names
IAP; Intestinal alkaline phosphatase
UniProt Entry Name
PPBI_HUMAN

NCBI Description

There are at least four distinct but related alkaline phosphatases: intestinal, placental, placental-like, and liver/bone/kidney (tissue non-specific). The intestinal alkaline phosphatase gene encodes a digestive brush-border enzyme. This enzyme is a component of the gut mucosal defense system and is thought to function in the detoxification of lipopolysaccharide, and in the prevention of bacterial translocation in the gut. [provided by RefSeq, Dec 2014]

Uniprot Description

ALPI: intestinal alkaline phosphatase is one of four related alkaline phosphatases. The exact physiological function of alkaline phosphatases is not known. This protein is a GPI-anchored membrane bound glycosylated enzyme that is localized to fetal and adult intestines.

Protein type: Cofactor and Vitamin Metabolism - folate biosynthesis; EC 3.1.3.1; Phosphatase; Membrane protein, GPI anchor; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q37.1

Molecular Function: alkaline phosphatase activity; magnesium ion binding; protease binding; protein binding; zinc ion binding

Biological Process: dephosphorylation

Research Articles on ALPI

Similar Products

Product Notes

The ALPI alpi (Catalog #AAA1276109) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggggc cctgggtgct gctgctgctg ggcctgaggc tacagctctc cctgggcgtc atcccagctg aggaggagaa cccggccttc tggaaccgcc aggcagctga ggccctggat gctgccaaga agctgcagcc catccagaag gtcgccaaga acctcatcct cttcctgggc gatgggttgg gggtgcccac ggtgacagcc accaggatcc taaaggggca gaagaatggc aaactggggc ctgagacgcc cctggccatg gaccgcttcc catacctggc tctgtccaag acatacaatg tggacagaca ggtgccagac agcgcagcca cagccacggc ctacctgtgc ggggtcaagg ccaacttcca gaccatcggc ttgagtgcag ccgcccgctt taaccagtgc aacacgacac gcggcaatga ggtcatctcc gtgatgaacc gggccaagca agcaggaaag tcagtaggag tggtgaccac cacacgggtg cagcacgcct cgccagccgg cacctacgca cacacagtga accgcaactg gtactcagat gctgacatgc ctgcctcagc ccgccaggag gggtgccagg acatcgccac tcagctcatc tccaacatgg acattgacgt gatccttggc ggaggccgca agtacatgtt tcccatgggg accccagacc ctgagtaccc agctgatgcc agccagaatg gaatcaggct ggacgggaag aacctggtgc aggaatggct ggcaaagcac cagggtgcct ggtatgtgtg gaaccgcact gagctcatgc aggcgtccct ggaccagtct gtgacccatc tcatgggcct ctttgagccc ggagacacga aatatgagat ccaccgagac cccacactgg acccctccct gatggagatg acagaggctg ccctgcgcct gctgagcagg aacccccgcg gcttctacct ctttgtggag ggcggccgca tcgaccatgg tcatcatgag ggtgtggctt accaggcact cactgaggcg gtcatgttcg acgacgccat tgagagggcg ggccagctca ccagcgagga ggacacgctg accctcgtca ccgctgacca ctcccatgtc ttctcctttg gtggctacac cttgcgaggg agctccatct tcgggttggc ccccagcaag gctcaggaca gcaaagccta cacgtccatc ctgtacggca atggcccggg ctacgtgttc aactcaggcg tgcgaccaga cgtgaatgag agcgagagcg ggagccccga ttaccagcag caggcggcgg tgcccctgtc gtccgagacc cacggaggcg aagacgtggc ggtgtttgcg cgcggcccgc aggcgcacct ggtgcatggt gtgcaggagc agagcttcgt agcgcatgtc atggccttcg ctgcctgtct ggagccctac acggcctgcg acctggcgcc tcccgcctgc accaccgacg ccgcgcaccc agttgccgcg tcgctgccac tgctggccgg gaccctgctg ctgctggggg cgtccgctgc tccctga. It is sometimes possible for the material contained within the vial of "ALPI, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.