Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARNTL cdna clone

ARNTL cDNA Clone

Gene Names
ARNTL; TIC; JAP3; MOP3; BMAL1; PASD3; BMAL1c; bHLHe5
Synonyms
ARNTL; ARNTL cDNA Clone; ARNTL cdna clone
Ordering
For Research Use Only!
Sequence
atggcagaccagagaatggacatttcttcaaccatcagtgatttcatgtccccgggccccaccgacctgctttccagctctcttggtaccagtggtgtggattgcaaccgcaaacggaaaggcagctccactgactaccaagaaagcatggacacagacaaagatgaccctcatggaaggttagaatatacagaacaccaaggaaggataaaaaatgcaagggaagctcacagtcagattgaaaagcggcgtcgggataaaatgaacagttttatagatgaattggcttctttggtaccaacatgcaacgcaatgtccaggaaattagataaacttactgtgctaaggatggctgttcagcacatgaaaacattaagaggtgccaccaatccatacacagaagcaaactacaaaccaacttttctatcagacgatgaattgaaacacctcattctcagggcagcagatggatttttgtttgtcgtaggatgtgaccgagggaagatactctttgtctcagagtctgtcttcaagatcctcaactacagccagaatgatctgattggtcagagtttgtttgactacctgcatcctaaagatattgccaaagtcaaggagcagctctcctcctctgacaccgcaccccgggagcggctcatagatgcaaaaactggacttccagttaaaacagatataacccctgggccatctcgattatgttctggagcacgacgttctttcttctgtaggatgaagtgtaacaggccttcagtaaaggttgaagacaaggacttcccctctacctgctcaaagaaaaaagatcgaaaaagcttctgcacaatccacagcacaggctatttgaaaagctggccacccacaaagatggggctggatgaagacaacgaaccagacaatgaggggtgtaacctcagctgcctcgtcgcaattggacgactgcattctcatgtagttccacaaccagtgaacggggaaatcagggtgaaatctatggaatatgtttctcggcacgcgatagatggaaagtttgtttttgtagaccagagggcaacagctattttggcatatttaccacaagaacttctaggcacatcgtgttatgaatattttcaccaagatgacataggacatcttgcagaatgtcataggcaagttttacagacgagagaaaaaattacaactaattgctataaatttaaaatcaaagatggttcttttatcacactacggagtcgatggttcagtttcatgaacccttggaccaaggaagtagaatatattgtctcaactaacactgttgttttagccaacgtcctggaaggcggggacccaaccttcccacagctcacagcatccccccacagcatggacagcatgctgccctctggagaaggtggcccaaagaggacccaccccactgttccagggattccagggggaacccgggctggggcaggaaaaataggccgaatgattgctgaggaaatcatggaaatccacaggataagagggtcatcgccttctagctgtggctccagcccattgaacatcacgagtacgcctccccctgatgcctcttctccaggaggcaagaagattttaaatggagggactccagacattccttccagtggcctactatcaggccaggctcaggagaacccaggttatccatattctgatagttcttctattcttggtgagaacccccacataggtatagacatgattgacaacgaccaaggatcaagtagtcccagtaatgatgaggcagcaatggctgtcatcatgagcctcttggaagcagatgctggactgggtggccctgttgactttagtgacttgccatggccgctgtaa
Sequence Length
1878
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
406
Molecular Weight
64,136 Da
NCBI Official Full Name
Homo sapiens aryl hydrocarbon receptor nuclear translocator-like, mRNA
NCBI Official Synonym Full Names
aryl hydrocarbon receptor nuclear translocator like
NCBI Official Symbol
ARNTL
NCBI Official Synonym Symbols
TIC; JAP3; MOP3; BMAL1; PASD3; BMAL1c; bHLHe5
NCBI Protein Information
aryl hydrocarbon receptor nuclear translocator-like protein 1
UniProt Protein Name
Aryl hydrocarbon receptor nuclear translocator-like protein 1
UniProt Gene Name
ARNTL
UniProt Synonym Gene Names
BHLHE5; BMAL1; MOP3; PASD3; bHLHe5
UniProt Entry Name
BMAL1_HUMAN

NCBI Description

The protein encoded by this gene is a basic helix-loop-helix protein that forms a heterodimer with CLOCK. This heterodimer binds E-box enhancer elements upstream of Period (PER1, PER2, PER3) and Cryptochrome (CRY1, CRY2) genes and activates transcription of these genes. PER and CRY proteins heterodimerize and repress their own transcription by interacting in a feedback loop with CLOCK/ARNTL complexes. Defects in this gene have been linked to infertility, problems with gluconeogenesis and lipogenesis, and altered sleep patterns. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]

Uniprot Description

BMAL1: aryl hydrocarbon receptor nuclear translocator-like protein. A circadian regulatory protein and substrate of casein kinase I epsilon. Heterodimers bind to an E-box element (3'-CACGTG-5'), thereby activating transcription of PER1, and possibly of other circadian clock proteins. Seven splice isoforms have been reported.

Protein type: DNA-binding; Transcription factor

Chromosomal Location of Human Ortholog: 11p15

Cellular Component: intracellular membrane-bound organelle; nucleoplasm; nucleus; transcription factor complex

Molecular Function: aryl hydrocarbon receptor binding; DNA binding; Hsp90 protein binding; protein binding; sequence-specific DNA binding

Biological Process: circadian regulation of gene expression; circadian rhythm; negative regulation of fat cell differentiation; negative regulation of TOR signaling pathway; negative regulation of transcription, DNA-dependent; positive regulation of circadian rhythm; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; proteasomal ubiquitin-dependent protein catabolic process; regulation of cell cycle; regulation of hair cycle; regulation of insulin secretion; regulation of neurogenesis; regulation of transcription, DNA-dependent; response to redox state; spermatogenesis

Research Articles on ARNTL

Similar Products

Product Notes

The ARNTL arntl (Catalog #AAA1276097) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagacc agagaatgga catttcttca accatcagtg atttcatgtc cccgggcccc accgacctgc tttccagctc tcttggtacc agtggtgtgg attgcaaccg caaacggaaa ggcagctcca ctgactacca agaaagcatg gacacagaca aagatgaccc tcatggaagg ttagaatata cagaacacca aggaaggata aaaaatgcaa gggaagctca cagtcagatt gaaaagcggc gtcgggataa aatgaacagt tttatagatg aattggcttc tttggtacca acatgcaacg caatgtccag gaaattagat aaacttactg tgctaaggat ggctgttcag cacatgaaaa cattaagagg tgccaccaat ccatacacag aagcaaacta caaaccaact tttctatcag acgatgaatt gaaacacctc attctcaggg cagcagatgg atttttgttt gtcgtaggat gtgaccgagg gaagatactc tttgtctcag agtctgtctt caagatcctc aactacagcc agaatgatct gattggtcag agtttgtttg actacctgca tcctaaagat attgccaaag tcaaggagca gctctcctcc tctgacaccg caccccggga gcggctcata gatgcaaaaa ctggacttcc agttaaaaca gatataaccc ctgggccatc tcgattatgt tctggagcac gacgttcttt cttctgtagg atgaagtgta acaggccttc agtaaaggtt gaagacaagg acttcccctc tacctgctca aagaaaaaag atcgaaaaag cttctgcaca atccacagca caggctattt gaaaagctgg ccacccacaa agatggggct ggatgaagac aacgaaccag acaatgaggg gtgtaacctc agctgcctcg tcgcaattgg acgactgcat tctcatgtag ttccacaacc agtgaacggg gaaatcaggg tgaaatctat ggaatatgtt tctcggcacg cgatagatgg aaagtttgtt tttgtagacc agagggcaac agctattttg gcatatttac cacaagaact tctaggcaca tcgtgttatg aatattttca ccaagatgac ataggacatc ttgcagaatg tcataggcaa gttttacaga cgagagaaaa aattacaact aattgctata aatttaaaat caaagatggt tcttttatca cactacggag tcgatggttc agtttcatga acccttggac caaggaagta gaatatattg tctcaactaa cactgttgtt ttagccaacg tcctggaagg cggggaccca accttcccac agctcacagc atccccccac agcatggaca gcatgctgcc ctctggagaa ggtggcccaa agaggaccca ccccactgtt ccagggattc cagggggaac ccgggctggg gcaggaaaaa taggccgaat gattgctgag gaaatcatgg aaatccacag gataagaggg tcatcgcctt ctagctgtgg ctccagccca ttgaacatca cgagtacgcc tccccctgat gcctcttctc caggaggcaa gaagatttta aatggaggga ctccagacat tccttccagt ggcctactat caggccaggc tcaggagaac ccaggttatc catattctga tagttcttct attcttggtg agaaccccca cataggtata gacatgattg acaacgacca aggatcaagt agtcccagta atgatgaggc agcaatggct gtcatcatga gcctcttgga agcagatgct ggactgggtg gccctgttga ctttagtgac ttgccatggc cgctgtaa. It is sometimes possible for the material contained within the vial of "ARNTL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.