Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GGA1 cdna clone

GGA1 cDNA Clone

Synonyms
GGA1; GGA1 cDNA Clone; GGA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagcccgcgatggagccggagactctggaggcgcgaatcaatagagccacgaaccccctgaacaaggagctcgactgggccagcatcaacggcttctgcgagcagctcaacgaggactttgaggggcctccactcgccacccggctgctggcccacaagatccagtccccacaggagtgggaggcgatccaggccttgacggtgagaaggggagaggccaccatccgtcccccgccatgtgacgacaccaagggaggccaagactga
Sequence Length
270
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
72,277 Da
NCBI Official Full Name
Homo sapiens golgi associated, gamma adaptin ear containing, ARF binding protein 1, mRNA
NCBI Official Synonym Full Names
golgi associated, gamma adaptin ear containing, ARF binding protein 1
NCBI Official Symbol
GGA1
NCBI Protein Information
ADP-ribosylation factor-binding protein GGA1
UniProt Protein Name
ADP-ribosylation factor-binding protein GGA1
UniProt Gene Name
GGA1
UniProt Entry Name
GGA1_HUMAN

NCBI Description

This gene encodes a member of the Golgi-localized, gamma adaptin ear-containing, ARF-binding (GGA) protein family. Members of this family are ubiquitous coat proteins that regulate the trafficking of proteins between the trans-Golgi network and the lysosome. These proteins share an amino-terminal VHS domain which mediates sorting of the mannose 6-phosphate receptors at the trans-Golgi network. They also contain a carboxy-terminal region with homology to the ear domain of gamma-adaptins. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

GGA1: Plays a role in protein sorting and trafficking between the trans-Golgi network (TGN) and endosomes. Mediates the ARF- dependent recruitment of clathrin to the TGN and binds ubiquitinated proteins and membrane cargo molecules with a cytosolic acidic cluster-dileucine (AC-LL) motif. Belongs to the GGA protein family. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Vesicle

Chromosomal Location of Human Ortholog: 22q13.31

Cellular Component: endosome membrane; Golgi apparatus; intracellular membrane-bound organelle; membrane; nucleoplasm

Molecular Function: protein binding

Biological Process: cellular protein metabolic process; intracellular protein transport

Research Articles on GGA1

Similar Products

Product Notes

The GGA1 gga1 (Catalog #AAA1276095) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagcccg cgatggagcc ggagactctg gaggcgcgaa tcaatagagc cacgaacccc ctgaacaagg agctcgactg ggccagcatc aacggcttct gcgagcagct caacgaggac tttgaggggc ctccactcgc cacccggctg ctggcccaca agatccagtc cccacaggag tgggaggcga tccaggcctt gacggtgaga aggggagagg ccaccatccg tcccccgcca tgtgacgaca ccaagggagg ccaagactga. It is sometimes possible for the material contained within the vial of "GGA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.