Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAPKAPK3 cdna clone

MAPKAPK3 cDNA Clone

Gene Names
MAPKAPK3; 3PK; MK-3; MAPKAP3; MAPKAP-K3; MAPKAPK-3
Synonyms
MAPKAPK3; MAPKAPK3 cDNA Clone; MAPKAPK3 cdna clone
Ordering
For Research Use Only!
Sequence
atggatggtgaaacagcagaggagcaggggggccctgtgcccccgccagttgcacccggcggacccggcttgggcggtgctccgggggggcggcgggagcccaagaagtacgcagtgaccgacgactaccagttgtccaagcaggtgctgggcctgggtgtgaacggcaaagtgctggagtgcttccatcggcgcactggacagaagtgtgccctgaagctcctgtatgacagccccaaggcccggcaggaggtagaccatcactggcaggcttctggcggcccccatattgtctgcatcctggatgtgtatgagaacatgcaccatggcaagcgctgtctcctcatcatcatggaatgcatggaaggtggtgagttgttcagcaggattcaggagcgtggcgaccaggctttcactgagagagaagctgcagagataatgcgggatattggcactgccatccagtttctgcacagccataacattgcccaccgagatgtcaagcctgaaaacctactctacacatctaaggagaaagacgcagtgcttaagctcaccgattttggctttgctaaggagaccacccaaaatgccctgcagacaccctgctatactccctattatgtggcccctgaggtcctgggtccagagaagtatgacaagtcatgtgacatgtggtccctgggtgtcatcatgtacatcctcctttgtggcttcccacccttctactccaacacgggccaggccatctccccggggatgaagaggaggattcgcctgggccagtacggcttccccaatcctgagtggtcagaagtctctgaggatgccaagcagctgatccgcctcctgttgaagacagaccccacagagaggctgaccatcactcagttcatgaaccacccctggatcaaccaatcgatggtagtgccacagaccccactccacacggcccgagtgctgcaggaggacaaagaccactgggacgaagtcaaggaggagatgaccagtgccttggccactatgcgggtagactacgaccaggtgaagatcaaggacctgaagacctctaacaaccggctcctcaacaagaggagaaaaaagcaggcaggcagctcctctgcctcacagggctgcaacaaccagtag
Sequence Length
1149
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,987 Da
NCBI Official Full Name
Homo sapiens mitogen-activated protein kinase-activated protein kinase 3, mRNA
NCBI Official Synonym Full Names
mitogen-activated protein kinase-activated protein kinase 3
NCBI Official Symbol
MAPKAPK3
NCBI Official Synonym Symbols
3PK; MK-3; MAPKAP3; MAPKAP-K3; MAPKAPK-3
NCBI Protein Information
MAP kinase-activated protein kinase 3
UniProt Protein Name
MAP kinase-activated protein kinase 3
UniProt Gene Name
MAPKAPK3
UniProt Synonym Gene Names
MAPK-activated protein kinase 3; MAPKAP kinase 3; MAPKAP-K3; MAPKAPK-3; MK-3; 3pK
UniProt Entry Name
MAPK3_HUMAN

NCBI Description

This gene encodes a member of the Ser/Thr protein kinase family. This kinase functions as a mitogen-activated protein kinase (MAP kinase)- activated protein kinase. MAP kinases are also known as extracellular signal-regulated kinases (ERKs), act as an integration point for multiple biochemical signals. This kinase was shown to be activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation. Alternate splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Sep 2011]

Uniprot Description

MAPKAPK3: a member of the MAPKAPK family of protein kinases. Activated by growth inducers and stress stimulation of cells. In vitro studies demonstrated that ERK, p38 MAP kinase and Jun N-terminal kinase were all able to phosphorylate and activate this kinase, which suggested the role of this kinase as an integrative element of signaling in both mitogen and stress responses. This kinase was reported to interact with, phosphorylate and repress the activity of E47, which is a basic helix-loop-helix transcription factor known to be involved in the regulation of tissue-specific gene expression and cell differentiation.

Protein type: Kinase, protein; EC 2.7.11.1; Protein kinase, Ser/Thr (non-receptor); Protein kinase, CAMK; CAMK group; MAPKAPK family; MAPKAPK subfamily

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: calcium-dependent protein serine/threonine kinase activity; calmodulin binding; calmodulin-dependent protein kinase activity; MAP kinase kinase activity; protein binding; protein serine/threonine kinase activity

Biological Process: activation of MAPK activity; cell surface receptor linked signal transduction; peptidyl-serine phosphorylation; protein amino acid autophosphorylation; Ras protein signal transduction; response to cytokine stimulus; response to lipopolysaccharide; response to stress; signal transduction; toll-like receptor signaling pathway; vascular endothelial growth factor receptor signaling pathway

Research Articles on MAPKAPK3

Similar Products

Product Notes

The MAPKAPK3 mapkapk3 (Catalog #AAA1276027) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggatggtg aaacagcaga ggagcagggg ggccctgtgc ccccgccagt tgcacccggc ggacccggct tgggcggtgc tccggggggg cggcgggagc ccaagaagta cgcagtgacc gacgactacc agttgtccaa gcaggtgctg ggcctgggtg tgaacggcaa agtgctggag tgcttccatc ggcgcactgg acagaagtgt gccctgaagc tcctgtatga cagccccaag gcccggcagg aggtagacca tcactggcag gcttctggcg gcccccatat tgtctgcatc ctggatgtgt atgagaacat gcaccatggc aagcgctgtc tcctcatcat catggaatgc atggaaggtg gtgagttgtt cagcaggatt caggagcgtg gcgaccaggc tttcactgag agagaagctg cagagataat gcgggatatt ggcactgcca tccagtttct gcacagccat aacattgccc accgagatgt caagcctgaa aacctactct acacatctaa ggagaaagac gcagtgctta agctcaccga ttttggcttt gctaaggaga ccacccaaaa tgccctgcag acaccctgct atactcccta ttatgtggcc cctgaggtcc tgggtccaga gaagtatgac aagtcatgtg acatgtggtc cctgggtgtc atcatgtaca tcctcctttg tggcttccca cccttctact ccaacacggg ccaggccatc tccccgggga tgaagaggag gattcgcctg ggccagtacg gcttccccaa tcctgagtgg tcagaagtct ctgaggatgc caagcagctg atccgcctcc tgttgaagac agaccccaca gagaggctga ccatcactca gttcatgaac cacccctgga tcaaccaatc gatggtagtg ccacagaccc cactccacac ggcccgagtg ctgcaggagg acaaagacca ctgggacgaa gtcaaggagg agatgaccag tgccttggcc actatgcggg tagactacga ccaggtgaag atcaaggacc tgaagacctc taacaaccgg ctcctcaaca agaggagaaa aaagcaggca ggcagctcct ctgcctcaca gggctgcaac aaccagtag. It is sometimes possible for the material contained within the vial of "MAPKAPK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.