ZBTB8OS cdna clone
ZBTB8OS cDNA Clone
Gene Names
ZBTB8OS; ARCH; ARCH2
Synonyms
ZBTB8OS; ZBTB8OS cDNA Clone; ZBTB8OS cdna clone
Sequence
atggcgcaggaagaggaagatgttagagattacaatttgactgaagaacagaaggcgatcaaggccaagtatccgccagtcaataggaagtacgagtatttggatcatacagcagatgtccagttacacgcatggggagatactctggaggaagcatttgagcaatgtgcaatggccatgtttggttacatgacagatactgggacagtggagcccctccaaacagtagaagtagaaacccaaggagatgacttacagtctcttctgtttcactttttggatgaatggctttataagttcagtgctgatgaattcttcataccccgggtggggagaagaattttcattgtccaagcaccctcagggaacagaagtcaaagcaataacatattcagcaatgcaggtctataa
Sequence Length
411
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
15,709 Da
NCBI Official Full Name
Homo sapiens zinc finger and BTB domain containing 8 opposite strand, mRNA
NCBI Official Synonym Full Names
zinc finger and BTB domain containing 8 opposite strand
NCBI Official Symbol
ZBTB8OS
NCBI Official Synonym Symbols
ARCH; ARCH2
NCBI Protein Information
protein archease
UniProt Protein Name
Protein archease
UniProt Gene Name
ZBTB8OS
UniProt Synonym Gene Names
ARCH
UniProt Entry Name
ARCH_HUMAN
Uniprot Description
ZBTB8OS: Belongs to the archease family. 2 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 1p35.1
Cellular Component: nucleoplasm
Biological Process: tRNA splicing
Research Articles on ZBTB8OS
Similar Products
Product Notes
The ZBTB8OS zbtb8os (Catalog #AAA1276023) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcagg aagaggaaga tgttagagat tacaatttga ctgaagaaca gaaggcgatc aaggccaagt atccgccagt caataggaag tacgagtatt tggatcatac agcagatgtc cagttacacg catggggaga tactctggag gaagcatttg agcaatgtgc aatggccatg tttggttaca tgacagatac tgggacagtg gagcccctcc aaacagtaga agtagaaacc caaggagatg acttacagtc tcttctgttt cactttttgg atgaatggct ttataagttc agtgctgatg aattcttcat accccgggtg gggagaagaa ttttcattgt ccaagcaccc tcagggaaca gaagtcaaag caataacata ttcagcaatg caggtctata a. It is sometimes possible for the material contained within the vial of "ZBTB8OS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
