Test Data
(NAME: pENTR223.1RESISTANT MARKER: Spectinomycin resistant; 100 ug/ml)
MAGED2 cdna clone
MAGED2 cDNA Clone
Gene Names
MAGED2; 11B6; BCG1; BCG-1; HCA10; BARTS5; MAGE-D2
Synonyms
MAGED2; MAGED2 cDNA Clone; MAGED2 cdna clone
Sequence
atgtctgacacaagcgagagtggtgcaggtctaactcgcttccaggctgaagcttcagaaaaggacagtagctcgatgatgcagactctgttgacagtgacccagaatgtggaggtcccagagacaccgaaggcctcaaaggcactggaggtctcagaggatgtgaaggtctcaaaagcctctggggtctcaaaggccacagaggtctcaaagaccccagaggctcgggaggcacctgccacccaggcctcatctactactcagctgactgatacccaggttctggcagctgaaaacaagagtctagcagctgacaccaagaaacagaatgctgacccgcaggctgtgacaatgcctgccactgagaccaaaaaggtcagccatgtggctgatacaaaggtcaatacaaaggctcaggagactgaggctgcaccctctcaggccccagcagatgaacctgagcctgagagtgcagctgcccagtctcaggagaatcaggatactcggcccaaggtcaaagccaagaaagcccgaaaggtgaagcatctggatggggaagaggatggcagcagtgatcagagtcaggcttctggaaccacaggtggccgaagggtctcaaaggccctaatggcctcaatggcccgcagggcttcaaggggtcccatagccttttgggcccgcagggcatcaaggactcggttggctgcttgggcccggagagccttgctctccctgagatcacctaaagcccgtaggggcaaggctcgccgtagagctgccaagctccagtcatcccaagagcctgaagcaccaccacctcgggatgtggcccttttgcaagggagggcaaatgatttggtgaagtaccttttggctaaagaccagacgaagattcccatcaagcgctcggacatgctgaaggacatcatcaaagaatacactgatgtgtaccccgaaatcattgaacgagcaggctattccttggagaaggtatttgggattcaattgaaggaaattgataagaatgaccacttgtacattcttctcagcaccttagagcccactgatgcaggcatactgggaacgactaaggactcacccaagctgggtctgctcatggtgcttcttagcatcatcttcatgaatggaaatcggtccagtgaggctgtcatctgggaggtgctgcgcaagttggggctgcgccctgggatacatcattcactctttggggacgtgaagaagctcatcactgatgagtttgtgaagcagaagtacctggactatgccagagtccccaatagcaatccccctgaatatgagttcttctggggcctgcgctcttactatgagaccagcaagatgaaagtcctcaagtttgcctgcaaggtacaaaagaaggatcccaaggaatgggcagctcagtaccgagaggcgatggaagcggatttgaaggctgcagctgaggctgcagctgaagccaaggctagggccgagattagagctcgaatgggcattgggctcggctcggagaatgctgccgggccctgcaactgggacgaagctgatatcggaccctgggccaaagcccggatccaggcgggagcagaagctaaagccaaagcccaagagagtggcagtgccagcactggtgccagtaccagtaccaataacagtgccagtgccagtgccagcaccagtggtggcttcagtgctggtgccagcctgaccgccactctcacatttgggctcttcgctggccttggtggagctggtgccagcaccagtggcagctctggtgcctgtggtttctcctacaagtga
Sequence Length
1821
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
Test Data
(NAME: pENTR223.1RESISTANT MARKER: Spectinomycin resistant; 100 ug/ml)
Test Data
(NAME: pENTR223.1RESISTANT MARKER: Spectinomycin resistant; 100 ug/ml)
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
63,167 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family D, 2, mRNA
NCBI Official Synonym Full Names
MAGE family member D2
NCBI Official Symbol
MAGED2
NCBI Official Synonym Symbols
11B6; BCG1; BCG-1; HCA10; BARTS5; MAGE-D2
NCBI Protein Information
melanoma-associated antigen D2
UniProt Protein Name
Melanoma-associated antigen D2
Protein Family
UniProt Gene Name
MAGED2
UniProt Synonym Gene Names
BCG1; BCG-1
UniProt Entry Name
MAGD2_HUMAN
NCBI Description
This gene is a member of the MAGED gene family. The MAGED genes are clustered on chromosome Xp11. This gene is located in Xp11.2, a hot spot for X-linked mental retardation (XLMR). This gene may also be involved in several types of cancer, including breast cancer and melanoma. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]
Uniprot Description
MAGE-D2: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Unknown function
Chromosomal Location of Human Ortholog: Xp11.2
Cellular Component: membrane
Molecular Function: protein binding
Disease: Bartter Syndrome, Type 5, Antenatal, Transient
Research Articles on MAGED2
Similar Products
Product Notes
The MAGED2 maged2 (Catalog #AAA1275961) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctgaca caagcgagag tggtgcaggt ctaactcgct tccaggctga agcttcagaa aaggacagta gctcgatgat gcagactctg ttgacagtga cccagaatgt ggaggtccca gagacaccga aggcctcaaa ggcactggag gtctcagagg atgtgaaggt ctcaaaagcc tctggggtct caaaggccac agaggtctca aagaccccag aggctcggga ggcacctgcc acccaggcct catctactac tcagctgact gatacccagg ttctggcagc tgaaaacaag agtctagcag ctgacaccaa gaaacagaat gctgacccgc aggctgtgac aatgcctgcc actgagacca aaaaggtcag ccatgtggct gatacaaagg tcaatacaaa ggctcaggag actgaggctg caccctctca ggccccagca gatgaacctg agcctgagag tgcagctgcc cagtctcagg agaatcagga tactcggccc aaggtcaaag ccaagaaagc ccgaaaggtg aagcatctgg atggggaaga ggatggcagc agtgatcaga gtcaggcttc tggaaccaca ggtggccgaa gggtctcaaa ggccctaatg gcctcaatgg cccgcagggc ttcaaggggt cccatagcct tttgggcccg cagggcatca aggactcggt tggctgcttg ggcccggaga gccttgctct ccctgagatc acctaaagcc cgtaggggca aggctcgccg tagagctgcc aagctccagt catcccaaga gcctgaagca ccaccacctc gggatgtggc ccttttgcaa gggagggcaa atgatttggt gaagtacctt ttggctaaag accagacgaa gattcccatc aagcgctcgg acatgctgaa ggacatcatc aaagaataca ctgatgtgta ccccgaaatc attgaacgag caggctattc cttggagaag gtatttggga ttcaattgaa ggaaattgat aagaatgacc acttgtacat tcttctcagc accttagagc ccactgatgc aggcatactg ggaacgacta aggactcacc caagctgggt ctgctcatgg tgcttcttag catcatcttc atgaatggaa atcggtccag tgaggctgtc atctgggagg tgctgcgcaa gttggggctg cgccctggga tacatcattc actctttggg gacgtgaaga agctcatcac tgatgagttt gtgaagcaga agtacctgga ctatgccaga gtccccaata gcaatccccc tgaatatgag ttcttctggg gcctgcgctc ttactatgag accagcaaga tgaaagtcct caagtttgcc tgcaaggtac aaaagaagga tcccaaggaa tgggcagctc agtaccgaga ggcgatggaa gcggatttga aggctgcagc tgaggctgca gctgaagcca aggctagggc cgagattaga gctcgaatgg gcattgggct cggctcggag aatgctgccg ggccctgcaa ctgggacgaa gctgatatcg gaccctgggc caaagcccgg atccaggcgg gagcagaagc taaagccaaa gcccaagaga gtggcagtgc cagcactggt gccagtacca gtaccaataa cagtgccagt gccagtgcca gcaccagtgg tggcttcagt gctggtgcca gcctgaccgc cactctcaca tttgggctct tcgctggcct tggtggagct ggtgccagca ccagtggcag ctctggtgcc tgtggtttct cctacaagtg a. It is sometimes possible for the material contained within the vial of "MAGED2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
