Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

KCMF1 cdna clone

KCMF1 cDNA Clone

Gene Names
KCMF1; FIGC; PCMF; ZZZ1; DEBT91
Synonyms
KCMF1; KCMF1 cDNA Clone; KCMF1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcccgacatgaaggtgtcagctgtgatgcatgtttaaaaggaaattttcgaggtcgcagatataagtgtttaatttgctacgattacgatctttgtgcatcttgttatgaaagtggtgcaacaacaacaaggcatacaactgaccacccaatgcagtgcatattaacaagggtagattttgatttatactatggtggggaagctttctctgtagagcagccacagtcttttacttgtccctattgtggaaaaatgggctatacggagacatctcttcaagaacatgttacttctgaacatgcagaaacatcaacagaagtgatttgtccaatatgtgcagcgttacctggaggcgatcctaatcatgtcacggatgactttgcagctcatcttacacttgaacacagagcccctagagatttagatgaatcgagtggtgttcgacatgtacgtagaatgtttcaccctggccggggattaggaggtcctcgtgctcgtagatcaaacatgcactttactagcagttctactggtggactttcttcttctcagagttcatattctccaagcaatagggaagccatggatcctatagctgagcttttatctcagttatcaggagtgagacgttctgcaggaggacagcttaattcctctggcccttccgcttctcagttacaacaactgcagatgcagctgcagctagaacggcagcatgcccaggcagcacggcaacaactggagaccgcacgcaacgcaacccggcgtactaacacaagcagtgtcaccactacaatcacacaatccacagcaacaaccaacatagctaatacagaaagcagtcagcagactctacagaattcccagtttcttttaacaaggttgaatgatcctaaaatgtctgaaacggagcgccagtccatggaaagcgagcgtgcagaccgcagcctgtttgtccaagagctccttctgtccactttagtgcgtgaagagagctcatcctcagatgaggatgatcggggggagatggcagattttggtgctatgggctgtgtagatattatgcctttagatgttgctttagaaaacctaaatttaaaagagagtaataaaggaaatgagcctccaccacctcctctttga
Sequence Length
1146
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,945 Da
NCBI Official Full Name
Homo sapiens potassium channel modulatory factor 1, mRNA
NCBI Official Synonym Full Names
potassium channel modulatory factor 1
NCBI Official Symbol
KCMF1
NCBI Official Synonym Symbols
FIGC; PCMF; ZZZ1; DEBT91
NCBI Protein Information
E3 ubiquitin-protein ligase KCMF1
UniProt Protein Name
E3 ubiquitin-protein ligase KCMF1
UniProt Gene Name
KCMF1
UniProt Synonym Gene Names
FIGC; ZZZ1; PCMF
UniProt Entry Name
KCMF1_HUMAN

Uniprot Description

KCMF1: Has intrinsic E3 ubiquitin ligase activity and promotes ubiquitination. Belongs to the KCMF1 family.

Protein type: C2H2-type zinc finger protein; Ubiquitin conjugating system; Ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 2p11.2

Research Articles on KCMF1

Similar Products

Product Notes

The KCMF1 kcmf1 (Catalog #AAA1275927) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccgac atgaaggtgt cagctgtgat gcatgtttaa aaggaaattt tcgaggtcgc agatataagt gtttaatttg ctacgattac gatctttgtg catcttgtta tgaaagtggt gcaacaacaa caaggcatac aactgaccac ccaatgcagt gcatattaac aagggtagat tttgatttat actatggtgg ggaagctttc tctgtagagc agccacagtc ttttacttgt ccctattgtg gaaaaatggg ctatacggag acatctcttc aagaacatgt tacttctgaa catgcagaaa catcaacaga agtgatttgt ccaatatgtg cagcgttacc tggaggcgat cctaatcatg tcacggatga ctttgcagct catcttacac ttgaacacag agcccctaga gatttagatg aatcgagtgg tgttcgacat gtacgtagaa tgtttcaccc tggccgggga ttaggaggtc ctcgtgctcg tagatcaaac atgcacttta ctagcagttc tactggtgga ctttcttctt ctcagagttc atattctcca agcaataggg aagccatgga tcctatagct gagcttttat ctcagttatc aggagtgaga cgttctgcag gaggacagct taattcctct ggcccttccg cttctcagtt acaacaactg cagatgcagc tgcagctaga acggcagcat gcccaggcag cacggcaaca actggagacc gcacgcaacg caacccggcg tactaacaca agcagtgtca ccactacaat cacacaatcc acagcaacaa ccaacatagc taatacagaa agcagtcagc agactctaca gaattcccag tttcttttaa caaggttgaa tgatcctaaa atgtctgaaa cggagcgcca gtccatggaa agcgagcgtg cagaccgcag cctgtttgtc caagagctcc ttctgtccac tttagtgcgt gaagagagct catcctcaga tgaggatgat cggggggaga tggcagattt tggtgctatg ggctgtgtag atattatgcc tttagatgtt gctttagaaa acctaaattt aaaagagagt aataaaggaa atgagcctcc accacctcct ctttga. It is sometimes possible for the material contained within the vial of "KCMF1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.