Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF31 cdna clone

RNF31 cDNA Clone

Gene Names
RNF31; HOIP; ZIBRA
Synonyms
RNF31; RNF31 cDNA Clone; RNF31 cdna clone
Ordering
For Research Use Only!
Sequence
atgccgggggaggaagaggagcgggccttcctggtggcccgcgaggagctggcgagcgccctgaggagggattccgggcaggcgttttccctggagcagctccggccgctactagccagctctctgccgctagccgcccgctacctgcagctggacgccgcacgccttgtccgctgcaacgctcatggggagccccgaaactacctcaacaccctgtccacggctctgaacatcctggagaaatacggccgcaaccttctcagccctcagcggcctcggtactggcgtggtgtcaagtttaataaccctgtctttcgcagcacggtggatgctgtgcaggggggccgagatgtgctgcgattatatggctacacagaggagcaaccagatgggttgagcttccccgaagggcaggaggagccagatgagcaccaggttgctacagtcacactggaagtactgctgcttcggacagagctcagcctgctattgcagaatactcatccaagacagcaggcactggagcagctgttggaagacaaggttgaagatgatatgctgcagctttcagaatttgaccccctattgagagagattgctcctggccccctcaccacaccctctgtcccaggctccactcctggtccctgcttcctctgtggttctgccccaggcacactgcactgcccatcctgtaaacaggccctgtgtccagcctgtgaccacctgttccatggacacccatcccgtgctcatcacctccgccagaccctgcctggggtcctgcagggtacccacctgagccccagtttacctgcctcagcccaaccacggccccagtcgacctccctgctggccctgggagacagctctctttcttcccctaatcctgcaagtgctcatttgccctggcactgtgctgcctgtgccatgctaaatgagccttgggcagtgctctgtgtggcctgtgatcggccccgaggctgtaaggggttggggttgggaactgagggtccccaaggaactggaggcctagaacctgatcttgcacggggtcggtgggcctgccagagctgtacctttgagaatgaggcagctgctgtgctatgttccatatgtgagcgacctcggctggcccagcctcccagcttggtggtggattcccgagatgctggcatttgcctgcaaccccttcagcagggggatgctttgctggcctctgcccagagtcaagtctggtactgtattcactgtaccttctgcaactcgagccctggctgggtgtgtgttatgtgcaaccggactagtagccccattccagcacaacatgccccccggccctatgccagctctttggaaaagggaccccccaagcctgggcccccacgacgccttagtgcccccctgcccagttcctgtggagatcctgagaagcagcgccaagacaagatgcgggaagaaggcctccagctagtgagcatgatccgggaaggggaagccgcaggtgcctgtccagaggagatcttctcggctctgcagtactcgggcactgaggtgcctctgcagtggttgcgctcagaactgccctacgtcctggagatggtggctgagctggctggacagcaggaccctgggctgggtgccttttcctgtcaggaggcccggagagcctggctggatcgtcatggcaaccttgatgaagctgtggaggagtgtgtgaggaccaggcgaaggaaggtgcaggagctccagtctctaggctttgggcctgaggaggggtctctccaggcattgttccagcacggaggtgatgtgtcacgggccctgactgagctacagcgccaacgcctagagcccttccgccagcgcctctgggacagtggccctgagcccaccccttcctgggatgggccagacaagcagagcctggtcaggcggcttttggcagtctacgcactccccagctggggccgggcagagctggcactgtcactgctgcaggagacacccaggaactatgagttgggggatgtggtagaagctgtgaggcacagccaggaccgggccttcctgcgccgcttgcttgcccaggagtgtgccgtgtgtggctgggccctgccccacaaccggatgcaggccctgacttcctgtgagtgcaccatctgtcctgactgcttccgccagcacttcaccatcgccttgaaggagaagcacatcacagacatggtgtgccctgcctgtggccgccccgacctcaccgatgacacacagttgctcagctacttctctacccttgacatccagcttcgcgagagcctagagccagatgcctatgcgttgttccataagaagctgaccgagggtgtgctgatgcgggaccccaagttcttgtggtgtgcccagtgctcctttggcttcatatatgagcgtgagcagctggaggcaacttgtccccagtgtcaccagaccttctgtgtgcgctgcaagcgccagtgggaggagcagcaccgaggtcggagctgtgaggacttccagaactggaaacgcatgaacgacccagaataccaggcccagggcctagcaatgtatcttcaggaaaacggcattgactgccccaaatgcaagttctcgtacgccctggcccgaggaggctgcatgcactttcactgtacccagtgccgccaccagttctgcagcggctgctacaatgccttttacgccaagaataaatgtccagagcctaactgcagggtgaaaaagtccctgcacggccaccaccctcgagactgcctcttctacctgcgggactggactgctctccggcttcagaagctgctacaggacaataacgtcatgtttaatacagagcctccagctggggcccgggcagtccctggaggcggctgccgagtgatagagcagaaggaggttcccaatgggctcagggacgaagcttgtggcaaggaaactccagctggctatgccggcctgtgccaggcacactacaaagagtatcttgtgagcctcatcaatgcccactcgctggacccagccaccttgtatgaggtggaagagctggagacggccactgagcgctacctgcacgtacgcccccagcctttggctggagaggatccccctgcttaccaggcccgcttgttacagaagctgacagaagaggtacccttgggacagagtatcccccgcaggcggaagtag
Sequence Length
3219
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
102,496 Da
NCBI Official Full Name
Homo sapiens ring finger protein 31, mRNA
NCBI Official Synonym Full Names
ring finger protein 31
NCBI Official Symbol
RNF31
NCBI Official Synonym Symbols
HOIP; ZIBRA
NCBI Protein Information
E3 ubiquitin-protein ligase RNF31
UniProt Protein Name
E3 ubiquitin-protein ligase RNF31
UniProt Gene Name
RNF31
UniProt Synonym Gene Names
ZIBRA; HOIP
UniProt Entry Name
RNF31_HUMAN

NCBI Description

The protein encoded by this gene contains a RING finger, a motif present in a variety of functionally distinct proteins and known to be involved in protein-DNA and protein-protein interactions. The encoded protein is the E3 ubiquitin-protein ligase component of the linear ubiquitin chain assembly complex. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2015]

Uniprot Description

RNF31: E3 ubiquitin-protein ligase component of the LUBAC complex which conjugates linear ('M-1'-linked) polyubiquitin chains to substrates and plays a key role in NF-kappa-B activation and regulation of inflammation. LUBAC conjugates linear polyubiquitin to IKBKG and RIPK1 and is involved in activation of the canonical NF-kappa-B and the JNK signaling pathways. Linear ubiquitination mediated by the LUBAC complex interferes with TNF- induced cell death and thereby prevents inflammation. LUBAC is proposed to be recruited to the TNF-R1 signaling complex (TNF-RSC) following polyubiquitination of TNF-RSC components by BIRC2 and/or BIRC3 and to conjugate linear polyubiquitin to IKBKG and possibly other components contributing to the stability of the complex. Binds polyubiquitin of different linkage types. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.19; Ubiquitin ligase; Ubiquitin conjugating system; Ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 14q11.2

Cellular Component: cytosol; internal side of plasma membrane

Molecular Function: protein binding; ubiquitin binding; ubiquitin protein ligase binding; ubiquitin-protein ligase activity

Biological Process: activation of NF-kappaB transcription factor; I-kappaB kinase/NF-kappaB cascade; positive regulation of I-kappaB kinase/NF-kappaB cascade; protein polyubiquitination; T cell receptor signaling pathway

Research Articles on RNF31

Similar Products

Product Notes

The RNF31 rnf31 (Catalog #AAA1275917) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccggggg aggaagagga gcgggccttc ctggtggccc gcgaggagct ggcgagcgcc ctgaggaggg attccgggca ggcgttttcc ctggagcagc tccggccgct actagccagc tctctgccgc tagccgcccg ctacctgcag ctggacgccg cacgccttgt ccgctgcaac gctcatgggg agccccgaaa ctacctcaac accctgtcca cggctctgaa catcctggag aaatacggcc gcaaccttct cagccctcag cggcctcggt actggcgtgg tgtcaagttt aataaccctg tctttcgcag cacggtggat gctgtgcagg ggggccgaga tgtgctgcga ttatatggct acacagagga gcaaccagat gggttgagct tccccgaagg gcaggaggag ccagatgagc accaggttgc tacagtcaca ctggaagtac tgctgcttcg gacagagctc agcctgctat tgcagaatac tcatccaaga cagcaggcac tggagcagct gttggaagac aaggttgaag atgatatgct gcagctttca gaatttgacc ccctattgag agagattgct cctggccccc tcaccacacc ctctgtccca ggctccactc ctggtccctg cttcctctgt ggttctgccc caggcacact gcactgccca tcctgtaaac aggccctgtg tccagcctgt gaccacctgt tccatggaca cccatcccgt gctcatcacc tccgccagac cctgcctggg gtcctgcagg gtacccacct gagccccagt ttacctgcct cagcccaacc acggccccag tcgacctccc tgctggccct gggagacagc tctctttctt cccctaatcc tgcaagtgct catttgccct ggcactgtgc tgcctgtgcc atgctaaatg agccttgggc agtgctctgt gtggcctgtg atcggccccg aggctgtaag gggttggggt tgggaactga gggtccccaa ggaactggag gcctagaacc tgatcttgca cggggtcggt gggcctgcca gagctgtacc tttgagaatg aggcagctgc tgtgctatgt tccatatgtg agcgacctcg gctggcccag cctcccagct tggtggtgga ttcccgagat gctggcattt gcctgcaacc ccttcagcag ggggatgctt tgctggcctc tgcccagagt caagtctggt actgtattca ctgtaccttc tgcaactcga gccctggctg ggtgtgtgtt atgtgcaacc ggactagtag ccccattcca gcacaacatg ccccccggcc ctatgccagc tctttggaaa agggaccccc caagcctggg cccccacgac gccttagtgc ccccctgccc agttcctgtg gagatcctga gaagcagcgc caagacaaga tgcgggaaga aggcctccag ctagtgagca tgatccggga aggggaagcc gcaggtgcct gtccagagga gatcttctcg gctctgcagt actcgggcac tgaggtgcct ctgcagtggt tgcgctcaga actgccctac gtcctggaga tggtggctga gctggctgga cagcaggacc ctgggctggg tgccttttcc tgtcaggagg cccggagagc ctggctggat cgtcatggca accttgatga agctgtggag gagtgtgtga ggaccaggcg aaggaaggtg caggagctcc agtctctagg ctttgggcct gaggaggggt ctctccaggc attgttccag cacggaggtg atgtgtcacg ggccctgact gagctacagc gccaacgcct agagcccttc cgccagcgcc tctgggacag tggccctgag cccacccctt cctgggatgg gccagacaag cagagcctgg tcaggcggct tttggcagtc tacgcactcc ccagctgggg ccgggcagag ctggcactgt cactgctgca ggagacaccc aggaactatg agttggggga tgtggtagaa gctgtgaggc acagccagga ccgggccttc ctgcgccgct tgcttgccca ggagtgtgcc gtgtgtggct gggccctgcc ccacaaccgg atgcaggccc tgacttcctg tgagtgcacc atctgtcctg actgcttccg ccagcacttc accatcgcct tgaaggagaa gcacatcaca gacatggtgt gccctgcctg tggccgcccc gacctcaccg atgacacaca gttgctcagc tacttctcta cccttgacat ccagcttcgc gagagcctag agccagatgc ctatgcgttg ttccataaga agctgaccga gggtgtgctg atgcgggacc ccaagttctt gtggtgtgcc cagtgctcct ttggcttcat atatgagcgt gagcagctgg aggcaacttg tccccagtgt caccagacct tctgtgtgcg ctgcaagcgc cagtgggagg agcagcaccg aggtcggagc tgtgaggact tccagaactg gaaacgcatg aacgacccag aataccaggc ccagggccta gcaatgtatc ttcaggaaaa cggcattgac tgccccaaat gcaagttctc gtacgccctg gcccgaggag gctgcatgca ctttcactgt acccagtgcc gccaccagtt ctgcagcggc tgctacaatg ccttttacgc caagaataaa tgtccagagc ctaactgcag ggtgaaaaag tccctgcacg gccaccaccc tcgagactgc ctcttctacc tgcgggactg gactgctctc cggcttcaga agctgctaca ggacaataac gtcatgttta atacagagcc tccagctggg gcccgggcag tccctggagg cggctgccga gtgatagagc agaaggaggt tcccaatggg ctcagggacg aagcttgtgg caaggaaact ccagctggct atgccggcct gtgccaggca cactacaaag agtatcttgt gagcctcatc aatgcccact cgctggaccc agccaccttg tatgaggtgg aagagctgga gacggccact gagcgctacc tgcacgtacg cccccagcct ttggctggag aggatccccc tgcttaccag gcccgcttgt tacagaagct gacagaagag gtacccttgg gacagagtat cccccgcagg cggaagtag. It is sometimes possible for the material contained within the vial of "RNF31, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.