Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MRPL18 cdna clone

MRPL18 cDNA Clone

Gene Names
MRPL18; L18mt; HSPC071; MRP-L18
Synonyms
MRPL18; MRPL18 cDNA Clone; MRPL18 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgcttcggtcgcggttttgggggttgttctcggtttgcaggaaccctgggtgcaggttcgcagccctgtcaaccagctccgagccggcagcgaaacctgaagtggaccctgtggaaaatgaagctgtcgccccagaattcaccaaccggaacccccggaacctggagcttttatctgtagccaggaaagagcggggctggcggacggtgtttccctcccgtgagttctggcacaggttgcgagttataaggactcagcatcatgtagaagcacttgtggagcatcagaatggcaaggttgtggtttcggcctccactcgtgagtgggctattaaaaagcacctttatagtaccagaaatgtggtggcttgtgagagtataggacgagtgctggcacagagatgcttagaggcgggaatcaacttcatggtctaccaaccaaccccgtgggaggcagcctcagactcgatgaaacgactacaaagtgccatgacagaaggtggtgtggttctacgggaacctcagagaatctatgaataa
Sequence Length
543
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
20,577 Da
NCBI Official Full Name
Homo sapiens mitochondrial ribosomal protein L18, mRNA
NCBI Official Synonym Full Names
mitochondrial ribosomal protein L18
NCBI Official Symbol
MRPL18
NCBI Official Synonym Symbols
L18mt; HSPC071; MRP-L18
NCBI Protein Information
39S ribosomal protein L18, mitochondrial
UniProt Protein Name
39S ribosomal protein L18, mitochondrial
UniProt Gene Name
MRPL18
UniProt Synonym Gene Names
L18mt; MRP-L18
UniProt Entry Name
RM18_HUMAN

NCBI Description

This nuclear gene encodes a protein component of the larger 39S subunit of mitochondrial ribosome. This protein may also aid in the import of nuclear-encoded 5S rRNA into mitochondria. Alternative splicing results in multiple transcript variants, most of which are not predicted to encode a protein. A pseudogene of this gene is found on chromosome 16. [provided by RefSeq, Jan 2016]

Uniprot Description

MRPL18: Together with thiosulfate sulfurtransferase (TST), acts as a mitochondrial import factor for the cytosolic 5S rRNA. The precursor form shows RNA chaperone activity; is able to fold the 5S rRNA into an import-competent conformation that is recognized by rhodanese (TST). Both the cytoplasmic and mitochondrial forms are able to bind to the helix IV-loop D in the gamma domain of the 5S rRNA. Belongs to the ribosomal protein L18P family.

Protein type: Ribosomal; Translation; Mitochondrial

Chromosomal Location of Human Ortholog: 6q25.3

Cellular Component: extracellular space; mitochondrial inner membrane; mitochondrion

Molecular Function: 5S rRNA binding

Research Articles on MRPL18

Similar Products

Product Notes

The MRPL18 mrpl18 (Catalog #AAA1275913) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgcttc ggtcgcggtt ttgggggttg ttctcggttt gcaggaaccc tgggtgcagg ttcgcagccc tgtcaaccag ctccgagccg gcagcgaaac ctgaagtgga ccctgtggaa aatgaagctg tcgccccaga attcaccaac cggaaccccc ggaacctgga gcttttatct gtagccagga aagagcgggg ctggcggacg gtgtttccct cccgtgagtt ctggcacagg ttgcgagtta taaggactca gcatcatgta gaagcacttg tggagcatca gaatggcaag gttgtggttt cggcctccac tcgtgagtgg gctattaaaa agcaccttta tagtaccaga aatgtggtgg cttgtgagag tataggacga gtgctggcac agagatgctt agaggcggga atcaacttca tggtctacca accaaccccg tgggaggcag cctcagactc gatgaaacga ctacaaagtg ccatgacaga aggtggtgtg gttctacggg aacctcagag aatctatgaa taa. It is sometimes possible for the material contained within the vial of "MRPL18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.