PCK2 cdna clone
PCK2 cDNA Clone
Gene Names
PCK2; PEPCK; PEPCK2; PEPCK-M
Synonyms
PCK2; PCK2 cDNA Clone; PCK2 cdna clone
Sequence
atggccgcattgtaccgccctggcctgcggcttaactggcatgggctgagccccttgggctggccatcatgccgtagcatccagaccctgcgagtgcttagtggagatctgggccagcttcccactggcattcgagattttgtagagcacagtgcccgcctgtgccaaccagagggcatccacatctgtgatggaactgaggctgagaatactgccacactgaccctgctggagcagcagggcctcatccgaaagctccccaagtacaataactgctggctggcccgcacagaccccaaggatgtggcacgagtagagagcaagacggtgattgtaactccttctcagcgggacacggtaccactcccgcctggtggggcccgtgggcagctgggcaactggatgtccccagctgatttccagcgagctgtggatgagaggtttccaggctgcatgcagggccgcaccatgtatgtgcttccattcagcatgggtcctgtgggctccccgctgtcccgcatcggggtgcagctcactgactcagcctatgtggtggcaagcatgcgtattatgacccgactggggacacctgtgcttcaggccctgggagatggtgactttgtcaagtgtctgcactccgtgggccagcccctgacaggacaaggggagccagtgagccagtggccgtgcaacccagagaaaaccctgattggccacgtgcccgaccagcgggagatcatctccttcggcagcggctatggtggcaactccctgctgggcaagaagtgctttgccctacgcatcgcctctcggctggcccgggatgagggctggctggcagagcacatgctgatcctgggcatcaccagccctgcagggaagaagcgctatgtggcagccgccttccctagtgcctgtggcaagaccaacctggctatgatgcggcctgcactgccaggctggaaagtggagtgtgtgggggatgatattgcttggatgaggtttgacagtgaaggtcgactccgggccatcaaccctgagaacggcttctttggggttgcccctggtacctctgccaccaccaatcccaacgccatggctacaatccagagtaacactatttttaccaatgtggctgagaccagtgatggtggcgtgtactgggagggcattgaccagcctcttccacctggtgttactgtgacctcctggctgggcaaaccctggaaacctggtgacaaggagccctgtgcacatcccaactctcgattttgtgccccggctcgccagtgccccatcatggacccagcctgggaggccccagagggtgtccccattgacgccatcatctttggtggccgcagacccaaaggggtacccctggtatacgaggccttcaactggcgtcatggggtgtttgtgggcagcgccatgcgctctgagtccactgctgcagcagaacacaaagggaagatcatcatgcacgacccatttgccatgcggcccttttttggctacaacttcgggcactacctggaacactggctgagcatggaagggcgcaagggggcccagctgccccgtatcttccatgtcaactggttccggcgtgacgaggcagggcacttcctgtggccaggctttggggagaatgctcgggtgctagactggatctgccggcggttagagggggaggacagtgcccgagagacacccattgggctggtgccaaaggaaggagccttggatctcagcggcctcagagctatagacaccactcagctgttctccctccccaaggacttctgggaacaggaggttcgtgacattcggagctacctgacagagcaggtcaaccaggatctgcccaaagaggtgttggctgagcttgaggccctggagagacgtgtgcacaaaatgtga
Sequence Length
1923
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
47,564 Da
NCBI Official Full Name
Homo sapiens phosphoenolpyruvate carboxykinase 2 (mitochondrial), mRNA
NCBI Official Synonym Full Names
phosphoenolpyruvate carboxykinase 2, mitochondrial
NCBI Official Symbol
PCK2
NCBI Official Synonym Symbols
PEPCK; PEPCK2; PEPCK-M
NCBI Protein Information
phosphoenolpyruvate carboxykinase [GTP], mitochondrial
UniProt Protein Name
Phosphoenolpyruvate carboxykinase [GTP], mitochondrial
Protein Family
UniProt Gene Name
PCK2
UniProt Synonym Gene Names
PEPCK2; PEPCK-M
UniProt Entry Name
PCKGM_HUMAN
NCBI Description
This gene encodes a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of guanosine triphosphate (GTP). A cytosolic form of this protein is encoded by a different gene and is the key enzyme of gluconeogenesis in the liver. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2014]
Uniprot Description
PCK2: Catalyzes the conversion of oxaloacetate (OAA) to phosphoenolpyruvate (PEP), the rate-limiting step in the metabolic pathway that produces glucose from lactate and other precursors derived from the citric acid cycle. Monomer. Belongs to the phosphoenolpyruvate carboxykinase [GTP] family. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Carbohydrate Metabolism - citrate (TCA) cycle; Carbohydrate Metabolism - pyruvate; Carbohydrate Metabolism - glycolysis and gluconeogenesis; Mitochondrial; Kinase, other; Lyase; EC 4.1.1.32
Chromosomal Location of Human Ortholog: 14q11.2
Cellular Component: mitochondrial matrix; mitochondrion
Molecular Function: phosphoenolpyruvate carboxykinase (GTP) activity; phosphoenolpyruvate carboxykinase activity; protein binding
Biological Process: gluconeogenesis
Disease: Phosphoenolpyruvate Carboxykinase Deficiency, Mitochondrial
Research Articles on PCK2
Similar Products
Product Notes
The PCK2 pck2 (Catalog #AAA1275897) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgcat tgtaccgccc tggcctgcgg cttaactggc atgggctgag ccccttgggc tggccatcat gccgtagcat ccagaccctg cgagtgctta gtggagatct gggccagctt cccactggca ttcgagattt tgtagagcac agtgcccgcc tgtgccaacc agagggcatc cacatctgtg atggaactga ggctgagaat actgccacac tgaccctgct ggagcagcag ggcctcatcc gaaagctccc caagtacaat aactgctggc tggcccgcac agaccccaag gatgtggcac gagtagagag caagacggtg attgtaactc cttctcagcg ggacacggta ccactcccgc ctggtggggc ccgtgggcag ctgggcaact ggatgtcccc agctgatttc cagcgagctg tggatgagag gtttccaggc tgcatgcagg gccgcaccat gtatgtgctt ccattcagca tgggtcctgt gggctccccg ctgtcccgca tcggggtgca gctcactgac tcagcctatg tggtggcaag catgcgtatt atgacccgac tggggacacc tgtgcttcag gccctgggag atggtgactt tgtcaagtgt ctgcactccg tgggccagcc cctgacagga caaggggagc cagtgagcca gtggccgtgc aacccagaga aaaccctgat tggccacgtg cccgaccagc gggagatcat ctccttcggc agcggctatg gtggcaactc cctgctgggc aagaagtgct ttgccctacg catcgcctct cggctggccc gggatgaggg ctggctggca gagcacatgc tgatcctggg catcaccagc cctgcaggga agaagcgcta tgtggcagcc gccttcccta gtgcctgtgg caagaccaac ctggctatga tgcggcctgc actgccaggc tggaaagtgg agtgtgtggg ggatgatatt gcttggatga ggtttgacag tgaaggtcga ctccgggcca tcaaccctga gaacggcttc tttggggttg cccctggtac ctctgccacc accaatccca acgccatggc tacaatccag agtaacacta tttttaccaa tgtggctgag accagtgatg gtggcgtgta ctgggagggc attgaccagc ctcttccacc tggtgttact gtgacctcct ggctgggcaa accctggaaa cctggtgaca aggagccctg tgcacatccc aactctcgat tttgtgcccc ggctcgccag tgccccatca tggacccagc ctgggaggcc ccagagggtg tccccattga cgccatcatc tttggtggcc gcagacccaa aggggtaccc ctggtatacg aggccttcaa ctggcgtcat ggggtgtttg tgggcagcgc catgcgctct gagtccactg ctgcagcaga acacaaaggg aagatcatca tgcacgaccc atttgccatg cggccctttt ttggctacaa cttcgggcac tacctggaac actggctgag catggaaggg cgcaaggggg cccagctgcc ccgtatcttc catgtcaact ggttccggcg tgacgaggca gggcacttcc tgtggccagg ctttggggag aatgctcggg tgctagactg gatctgccgg cggttagagg gggaggacag tgcccgagag acacccattg ggctggtgcc aaaggaagga gccttggatc tcagcggcct cagagctata gacaccactc agctgttctc cctccccaag gacttctggg aacaggaggt tcgtgacatt cggagctacc tgacagagca ggtcaaccag gatctgccca aagaggtgtt ggctgagctt gaggccctgg agagacgtgt gcacaaaatg tga. It is sometimes possible for the material contained within the vial of "PCK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
