Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MKKS cdna clone

MKKS cDNA Clone

Gene Names
MKKS; KMS; MKS; BBS6; HMCS
Synonyms
MKKS; MKKS cDNA Clone; MKKS cdna clone
Ordering
For Research Use Only!
Sequence
atgtctcgtttggaagctaagaagccatcattgtgtaagagtgaaccactgacaactgagagagtcaggaccacactttctgtcttgaaaagaattgtaacatcatgctatggcccttcaggtaggctgaagcagctgcacaatggctttggaggttacgtgtgtacaacctcacagtcctcagctctgctcagtcaccttttggtcacacatcccattttaaagatcctgacagcctccatacagaatcatgtgtcaagcttcagtgattgtggcttattcacagctattctttgctgcaacctgattgaaaatgttcagagattaggcttgacacccaccactgtcattagattaaataaacatcttttgagtctttgcatcagttatctcaagtctgagacctgtggttgtcgaatcccagtggactttagtagtactcagatcctcctttgtttggtgcgtagtatattaacaagtaaacctgcctgtatgctcaccagaaaggaaacagagcatgtcagtgctttgattctgagagcctttttgcttacaattccagaaaatgctgaaggccacatcattttaggaaagagtttaattgtacctttaaaaggtcaaagagttatagattccactgtattacctgggatactcattgaaatgtcagaagttcaattaatgaggctattacctatcaaaaaatcaactgccctcaaggtggcactcttttgtacaactttatccggagacacttctgacactggagaaggaactgtggtggtcagttatggggtttctcttgaaaatgcagtcttggaccagctgcttaacctaggaaggcagctaatcagtgaccacgtagatcttgtcctgtgccaaaaagttatacatccatctttgaagcagtttctcaatatgcatcgtattattgccatagacagaattggagtgactctgatggaacccctgactaaaatgacaggaacacagcctattggatccctaggctcaatatgtcctaatagttatggaagtgtgaaagatgtgtgcactgcaaaatttggctccaaacatttttttcatcttattcctaatgaagcaacaatctgcagcttgcttctctgcaacagaaatgacactgcctgggatgagctgaagctcacgtgtcagacggcactgcatgtcctgcagttaacactcaaggaaccatgggctttgttgggaggtggctgtactgaaactcatttggctgcatatatcagacacaagactcacaacgacccagaaagcattctcaaagatgatgaatgtactcaaacagaacttcaattaattgctgaagcattttgcagtgccctagaatctgttgttggctctttagaacatgatggaggtgaaattctcactgacatgaagtatggacacctttggtcagttcaggcagattctccctgtgttgctaactggccagatttgctttcacagtgtggctgtggattatacaatagccaggaagaactcaactggtctttcttaagaagcacatgtcgtccatttgtgccacaaagctgccttccacatgaagctgtggtctcagccagcaacctgaccttggactgtttgactgcaaagcttagtggcctacaggtggctgtagagacagccaatttgattttggatctttcatatgttattgaagataaaaactaa
Sequence Length
1713
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,342 Da
NCBI Official Full Name
Homo sapiens McKusick-Kaufman syndrome, mRNA
NCBI Official Synonym Full Names
McKusick-Kaufman syndrome
NCBI Official Symbol
MKKS
NCBI Official Synonym Symbols
KMS; MKS; BBS6; HMCS
NCBI Protein Information
McKusick-Kaufman/Bardet-Biedl syndromes putative chaperonin
UniProt Protein Name
McKusick-Kaufman/Bardet-Biedl syndromes putative chaperonin
UniProt Gene Name
MKKS
UniProt Synonym Gene Names
BBS6
UniProt Entry Name
MKKS_HUMAN

NCBI Description

This gene encodes a protein which shares sequence similarity with other members of the type II chaperonin family. The encoded protein is a centrosome-shuttling protein and plays an important role in cytokinesis. This protein also interacts with other type II chaperonin members to form a complex known as the BBSome, which involves ciliary membrane biogenesis. This protein is encoded by a downstream open reading frame (dORF). Several upstream open reading frames (uORFs) have been identified, which repress the translation of the dORF, and two of which can encode small mitochondrial membrane proteins. Mutations in this gene have been observed in patients with Bardet-Biedl syndrome type 6, also known as McKusick-Kaufman syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]

Uniprot Description

MKKS: Probable molecular chaperone. Assists the folding of proteins upon ATP hydrolysis. As part of the BBS/CCT complex may play a role in the assembly of BBSome, a complex involved in ciliogenesis regulating transports vesicles to the cilia. May play a role in protein processing in limb, cardiac and reproductive system development. May play a role in cytokinesis. Defects in MKKS are the cause of McKusick-Kaufman syndrome (MKKS). MKKS is an autosomal recessive developmental disorder. It is characterized by hydrometrocolpos, postaxial polydactyly and congenital heart defects. Defects in MKKS are the cause of Bardet-Biedl syndrome type 6 (BBS6). Bardet-Biedl syndrome (BBS) is a genetically heterogeneous, autosomal recessive disorder characterized by usually severe pigmentary retinopathy, early onset obesity, polydactyly, hypogenitalism, renal malformation and mental retardation. Secondary features include diabetes mellitus, hypertension and congenital heart disease. A relatively high incidence of BBS is found in the mixed Arab populations of Kuwait and in Bedouin tribes throughout the Middle East, most likely due to the high rate of consaguinity in these populations and a founder effect. Belongs to the TCP-1 chaperonin family.

Protein type: Chaperone; Cell development/differentiation

Chromosomal Location of Human Ortholog: 20p12

Cellular Component: centrosome; intracellular

Molecular Function: protein binding

Biological Process: brain morphogenesis; cerebral cortex development; cilium biogenesis; convergent extension involved in gastrulation; detection of mechanical stimulus involved in sensory perception of sound; determination of left/right symmetry; fat cell differentiation; gonad development; heart development; heart looping; hippocampus development; intracellular transport; melanosome transport; photoreceptor cell maintenance; pigment granule aggregation in cell center; sensory perception of smell; social behavior; spermatid development; striatum development

Disease: Bardet-biedl Syndrome 1; Bardet-biedl Syndrome 6; Mckusick-kaufman Syndrome

Research Articles on MKKS

Similar Products

Product Notes

The MKKS mkks (Catalog #AAA1275881) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtctcgtt tggaagctaa gaagccatca ttgtgtaaga gtgaaccact gacaactgag agagtcagga ccacactttc tgtcttgaaa agaattgtaa catcatgcta tggcccttca ggtaggctga agcagctgca caatggcttt ggaggttacg tgtgtacaac ctcacagtcc tcagctctgc tcagtcacct tttggtcaca catcccattt taaagatcct gacagcctcc atacagaatc atgtgtcaag cttcagtgat tgtggcttat tcacagctat tctttgctgc aacctgattg aaaatgttca gagattaggc ttgacaccca ccactgtcat tagattaaat aaacatcttt tgagtctttg catcagttat ctcaagtctg agacctgtgg ttgtcgaatc ccagtggact ttagtagtac tcagatcctc ctttgtttgg tgcgtagtat attaacaagt aaacctgcct gtatgctcac cagaaaggaa acagagcatg tcagtgcttt gattctgaga gcctttttgc ttacaattcc agaaaatgct gaaggccaca tcattttagg aaagagttta attgtacctt taaaaggtca aagagttata gattccactg tattacctgg gatactcatt gaaatgtcag aagttcaatt aatgaggcta ttacctatca aaaaatcaac tgccctcaag gtggcactct tttgtacaac tttatccgga gacacttctg acactggaga aggaactgtg gtggtcagtt atggggtttc tcttgaaaat gcagtcttgg accagctgct taacctagga aggcagctaa tcagtgacca cgtagatctt gtcctgtgcc aaaaagttat acatccatct ttgaagcagt ttctcaatat gcatcgtatt attgccatag acagaattgg agtgactctg atggaacccc tgactaaaat gacaggaaca cagcctattg gatccctagg ctcaatatgt cctaatagtt atggaagtgt gaaagatgtg tgcactgcaa aatttggctc caaacatttt tttcatctta ttcctaatga agcaacaatc tgcagcttgc ttctctgcaa cagaaatgac actgcctggg atgagctgaa gctcacgtgt cagacggcac tgcatgtcct gcagttaaca ctcaaggaac catgggcttt gttgggaggt ggctgtactg aaactcattt ggctgcatat atcagacaca agactcacaa cgacccagaa agcattctca aagatgatga atgtactcaa acagaacttc aattaattgc tgaagcattt tgcagtgccc tagaatctgt tgttggctct ttagaacatg atggaggtga aattctcact gacatgaagt atggacacct ttggtcagtt caggcagatt ctccctgtgt tgctaactgg ccagatttgc tttcacagtg tggctgtgga ttatacaata gccaggaaga actcaactgg tctttcttaa gaagcacatg tcgtccattt gtgccacaaa gctgccttcc acatgaagct gtggtctcag ccagcaacct gaccttggac tgtttgactg caaagcttag tggcctacag gtggctgtag agacagccaa tttgattttg gatctttcat atgttattga agataaaaac taa. It is sometimes possible for the material contained within the vial of "MKKS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.