Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CLEC1A cdna clone

CLEC1A cDNA Clone

Gene Names
CLEC1A; CLEC1; CLEC-1
Synonyms
CLEC1A; CLEC1A cDNA Clone; CLEC1A cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggccaagtacagcagcacgagggacatgctggatgatgatggggacaccaccatgagcctgcattctcaaggctctgccacaactcggcatccagagccccggcgcacagagcacagggctccctcttcaacgtggcgaccagtggccctgaccctgctgactttgtgcttggtgctgctgatagggctggcagccctggggcttttgttttttcagtactaccagctctccaatactggtcaagacaccatttctcaaatggaagaaagattaggaaatacgtcccaagagttgcaatctcttcaagtccagaatataaagcttgcaggaagtctgcagcatgtggctgaaaaactctgtcgtgagctgtataacaaagctggagcacacaggtgcagcccttgtacagaacaatggaaatggcatggagacaattgctaccagttctataaagacagcaaaagttgggaggactgtaaatatttctgccttagtgaaaactctaccatgctgaagataaacaaacaagaagacctggaatttgccgcgtctcagagctactctgagtttttctactcttattggacagggcttttgcgccctgacagtggcaaggcctggctgtggatggatggaacccctttcacttctgaactgttccatattataatagatgtcaccagcccaagaagcagagactgtgtggccatccttaatgggatgatcttctcaaaggactgcaaagaattgaagcgttgtgtctgtgagagaagggcaggaatggtgaagccagagagcctccatgtcccccctgaaacattaggcgaaggtgactga
Sequence Length
843
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
31,952 Da
NCBI Official Full Name
Homo sapiens C-type lectin domain family 1, member A, mRNA
NCBI Official Synonym Full Names
C-type lectin domain family 1 member A
NCBI Official Symbol
CLEC1A
NCBI Official Synonym Symbols
CLEC1; CLEC-1
NCBI Protein Information
C-type lectin domain family 1 member A
UniProt Protein Name
C-type lectin domain family 1 member A
UniProt Gene Name
CLEC1A
UniProt Synonym Gene Names
CLEC1; CLEC-1
UniProt Entry Name
CLC1A_HUMAN

NCBI Description

This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signaling, glycoprotein turnover, and roles in inflammation and immune response. The encoded protein may play a role in regulating dendritic cell function. This gene is closely linked to other CTL/CTLD superfamily members on chromosome 12p13 in the natural killer gene complex region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]

Uniprot Description

CLEC1A:

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 12p13.2

Cellular Component: integral to plasma membrane; intracellular

Molecular Function: transmembrane receptor activity

Biological Process: cell surface receptor linked signal transduction; defense response

Research Articles on CLEC1A

Similar Products

Product Notes

The CLEC1A clec1a (Catalog #AAA1275853) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggcca agtacagcag cacgagggac atgctggatg atgatgggga caccaccatg agcctgcatt ctcaaggctc tgccacaact cggcatccag agccccggcg cacagagcac agggctccct cttcaacgtg gcgaccagtg gccctgaccc tgctgacttt gtgcttggtg ctgctgatag ggctggcagc cctggggctt ttgttttttc agtactacca gctctccaat actggtcaag acaccatttc tcaaatggaa gaaagattag gaaatacgtc ccaagagttg caatctcttc aagtccagaa tataaagctt gcaggaagtc tgcagcatgt ggctgaaaaa ctctgtcgtg agctgtataa caaagctgga gcacacaggt gcagcccttg tacagaacaa tggaaatggc atggagacaa ttgctaccag ttctataaag acagcaaaag ttgggaggac tgtaaatatt tctgccttag tgaaaactct accatgctga agataaacaa acaagaagac ctggaatttg ccgcgtctca gagctactct gagtttttct actcttattg gacagggctt ttgcgccctg acagtggcaa ggcctggctg tggatggatg gaaccccttt cacttctgaa ctgttccata ttataataga tgtcaccagc ccaagaagca gagactgtgt ggccatcctt aatgggatga tcttctcaaa ggactgcaaa gaattgaagc gttgtgtctg tgagagaagg gcaggaatgg tgaagccaga gagcctccat gtcccccctg aaacattagg cgaaggtgac tga. It is sometimes possible for the material contained within the vial of "CLEC1A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.