Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINA7 cdna clone

SERPINA7 cDNA Clone

Gene Names
SERPINA7; TBG
Synonyms
SERPINA7; SERPINA7 cDNA Clone; SERPINA7 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcaccattcctgtatctggttctcttggtacttgggcttcatgctacaatccactgtgcatcacctgaaggcaaagtaacagcctgccattcatcccaaccaaatgccactctctacaagatgtcatccattaatgctgactttgcattcaatctgtaccggaggttcactgtggagaccccagataagaacatcttcttttcccctgtgagcatttctgcagctttggttatgctttcctttggggcctgctgcagcacccaaactgagattgtggagaccttggggttcaacctcacagacactccaatggtagagatccagcatggcttccagcatctgatctgttcactgaattttccaaagaaggaactggaattgcagataggaaatgccctcttcattggcaagcatctgaaaccactggcaaagttcttgaatgatgtcaagaccctctatgagactgaagtcttttctaccgacttctccaacatttctgcagccaagcaggagattaacagtcatgtggagatgcaaaccaaagggaaagttgtgggtctaattcaagacctcaagccaaacaccatcatggtcttagtgaactatattcactttaaagcccagtgggcaaatccttttgatccatccaagacagaagacagttccagcttcttaatagacaagaccaccactgttcaagtgcccatgatgcaccagatggaacaatactatcacctagtggatatggaattgaactgcacagttctgcaaatggactacagcaagaatgctctggcactctttgttcttcccaaggagggacagatggagtcagtggaagctgccatgtcatctaaaacactgaagaagtggaaccgcttactacagaagggatgggttgacttgtttgttccaaagttttccatttctgccacatatgaccttggagccacacttttgaagatgggcattcagcatgcctattctgaaaatgctgatttttctggactcacagaggacaatggtctgaaactttccaatgctgcccataaggctgtgctgcacattggtgaaaagggaactgaagctgcagctgtccctgaagttgaactttcggatcagcctgaaaacactttcctacaccctattatccaaattgatagatctttcatgttgttgattttggagagaagcacaaggagtattctctttctagggaaagttgtgaacccaacggaagcgtag
Sequence Length
1248
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,325 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 7, mRNA
NCBI Official Synonym Full Names
serpin family A member 7
NCBI Official Symbol
SERPINA7
NCBI Official Synonym Symbols
TBG
NCBI Protein Information
thyroxine-binding globulin
UniProt Protein Name
Thyroxine-binding globulin
UniProt Gene Name
SERPINA7
UniProt Synonym Gene Names
TBG
UniProt Entry Name
THBG_HUMAN

NCBI Description

There are three proteins including thyroxine-binding globulin (TBG), transthyretin and albumin responsible for carrying the thyroid hormones thyroxine (T4) and 3,5,3'-triiodothyronine (T3) in the bloodstream. This gene encodes the major thyroid hormone transport protein, TBG, in serum. It belongs to the serpin family in genomics, but the protein has no inhibitory function like many other members of the serpin family. Mutations in this gene result in TGB deficiency, which has been classified as partial deficiency, complete deficiency, and excess, based on the level of serum TBG. Alternatively spliced transcript variants encoding different isoforms have been found, but the full-length nature of these variants has not been determined.[provided by RefSeq, Jun 2012]

Uniprot Description

SERPINA7: Major thyroid hormone transport protein in serum. Defects in SERPINA7 are a cause of thyroxine-binding globulin deficiency (TBG deficiency). Mutations in the SERPINA7 gene can result as a whole spectrum of deficiencies, characterized by either reduced or increased TBG levels in the serum. Patients show, respectively, reduced or elevated protein- bound iodine but are euthyroid. Belongs to the serpin family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: Xq22.2

Molecular Function: serine-type endopeptidase inhibitor activity

Research Articles on SERPINA7

Similar Products

Product Notes

The SERPINA7 serpina7 (Catalog #AAA1275833) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcaccat tcctgtatct ggttctcttg gtacttgggc ttcatgctac aatccactgt gcatcacctg aaggcaaagt aacagcctgc cattcatccc aaccaaatgc cactctctac aagatgtcat ccattaatgc tgactttgca ttcaatctgt accggaggtt cactgtggag accccagata agaacatctt cttttcccct gtgagcattt ctgcagcttt ggttatgctt tcctttgggg cctgctgcag cacccaaact gagattgtgg agaccttggg gttcaacctc acagacactc caatggtaga gatccagcat ggcttccagc atctgatctg ttcactgaat tttccaaaga aggaactgga attgcagata ggaaatgccc tcttcattgg caagcatctg aaaccactgg caaagttctt gaatgatgtc aagaccctct atgagactga agtcttttct accgacttct ccaacatttc tgcagccaag caggagatta acagtcatgt ggagatgcaa accaaaggga aagttgtggg tctaattcaa gacctcaagc caaacaccat catggtctta gtgaactata ttcactttaa agcccagtgg gcaaatcctt ttgatccatc caagacagaa gacagttcca gcttcttaat agacaagacc accactgttc aagtgcccat gatgcaccag atggaacaat actatcacct agtggatatg gaattgaact gcacagttct gcaaatggac tacagcaaga atgctctggc actctttgtt cttcccaagg agggacagat ggagtcagtg gaagctgcca tgtcatctaa aacactgaag aagtggaacc gcttactaca gaagggatgg gttgacttgt ttgttccaaa gttttccatt tctgccacat atgaccttgg agccacactt ttgaagatgg gcattcagca tgcctattct gaaaatgctg atttttctgg actcacagag gacaatggtc tgaaactttc caatgctgcc cataaggctg tgctgcacat tggtgaaaag ggaactgaag ctgcagctgt ccctgaagtt gaactttcgg atcagcctga aaacactttc ctacacccta ttatccaaat tgatagatct ttcatgttgt tgattttgga gagaagcaca aggagtattc tctttctagg gaaagttgtg aacccaacgg aagcgtag. It is sometimes possible for the material contained within the vial of "SERPINA7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.