Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TCN1 cdna clone

TCN1 cDNA Clone

Gene Names
TCN1; HC; TC1; TCI; TC-1
Synonyms
TCN1; TCN1 cDNA Clone; TCN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgagacagtcacaccagctgcccctagtggggctcttactgttttcttttattccaagccaactatgcgagatttgtgaggtaagtgaagaaaactacatccgcctaaaacctctgttgaatacaatgatccagtcaaactataacaggggaaccagcgctgtcaatgttgtgttgtccctcaaacttgttggaatccagatccaaaccctgatgcaaaagatgatccaacaaatcaaatacaatgtgaaaagcagattgtcagatgtaagctcgggagagcttgccttgattatactggctttgggagtatgtcgtaacgctgaggaaaacttaatatatgattaccacctgatcgacaagctagaaaataaattccaagcagaaattgaaaatatggaagcacacaatggcactcccctgactaactactaccagctcagcctggacgttttggccttgtgtctgttcaatgggaactactcaaccgccgaagttgtcaaccacttcactcctgaaaataaaaactattattttggtagccagttctcagtagatactggtgcaatggctgtcctggctctgacctgtgtgaagaagagtctaataaatgggcagatcaaagcagatgaaggcagtttaaagaacatcagtatttatacaaagtcactggtagaaaagattctgtctgagaaaaaagaaaatggtctcattggaaacacatttagcacaggagaagccatgcaggccctctttgtatcatcagactattataatgaaaatgactggaattgccaacaaactctgaatacagtgctcacggaaatttctcaaggagcattcagtaatccaaacgctgcagcccaggtcttacctgccctgatgggaaagaccttcttggatattaacaaagactcttcttgcgtctctgcttcaggtaacttcaacatctccgctgatgagcctataactgtgacacctcctgactcacaatcatatatctccgtcaattactctgtgagaatcaatgaaacatatttcaccaatgtcactgtgctaaatggttctgtcttcctcagtgtgatggagaaagcccagaaaatgaatgatactatatttggtttcacaatggaggagcgctcatgggggccctatatcacctgtattcagggcctatgtgccaacaataatgacagaacctactgggaacttctgagtggaggcgaaccactgagccaaggagctggtagttacgttgtccgcaatggataa
Sequence Length
1272
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
NCBI Official Full Name
Homo sapiens transcobalamin I (vitamin B12 binding protein, R binder family), mRNA
NCBI Official Synonym Full Names
transcobalamin 1
NCBI Official Symbol
TCN1
NCBI Official Synonym Symbols
HC; TC1; TCI; TC-1
Protein Family

NCBI Description

This gene encodes a member of the vitamin B12-binding protein family. This family of proteins, alternatively referred to as R binders, is expressed in various tissues and secretions. This protein is a major constituent of secondary granules in neutrophils and facilitates the transport of cobalamin into cells. [provided by RefSeq, Jul 2008]

Research Articles on TCN1

Similar Products

Product Notes

The TCN1 (Catalog #AAA1275758) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagacagt cacaccagct gcccctagtg gggctcttac tgttttcttt tattccaagc caactatgcg agatttgtga ggtaagtgaa gaaaactaca tccgcctaaa acctctgttg aatacaatga tccagtcaaa ctataacagg ggaaccagcg ctgtcaatgt tgtgttgtcc ctcaaacttg ttggaatcca gatccaaacc ctgatgcaaa agatgatcca acaaatcaaa tacaatgtga aaagcagatt gtcagatgta agctcgggag agcttgcctt gattatactg gctttgggag tatgtcgtaa cgctgaggaa aacttaatat atgattacca cctgatcgac aagctagaaa ataaattcca agcagaaatt gaaaatatgg aagcacacaa tggcactccc ctgactaact actaccagct cagcctggac gttttggcct tgtgtctgtt caatgggaac tactcaaccg ccgaagttgt caaccacttc actcctgaaa ataaaaacta ttattttggt agccagttct cagtagatac tggtgcaatg gctgtcctgg ctctgacctg tgtgaagaag agtctaataa atgggcagat caaagcagat gaaggcagtt taaagaacat cagtatttat acaaagtcac tggtagaaaa gattctgtct gagaaaaaag aaaatggtct cattggaaac acatttagca caggagaagc catgcaggcc ctctttgtat catcagacta ttataatgaa aatgactgga attgccaaca aactctgaat acagtgctca cggaaatttc tcaaggagca ttcagtaatc caaacgctgc agcccaggtc ttacctgccc tgatgggaaa gaccttcttg gatattaaca aagactcttc ttgcgtctct gcttcaggta acttcaacat ctccgctgat gagcctataa ctgtgacacc tcctgactca caatcatata tctccgtcaa ttactctgtg agaatcaatg aaacatattt caccaatgtc actgtgctaa atggttctgt cttcctcagt gtgatggaga aagcccagaa aatgaatgat actatatttg gtttcacaat ggaggagcgc tcatgggggc cctatatcac ctgtattcag ggcctatgtg ccaacaataa tgacagaacc tactgggaac ttctgagtgg aggcgaacca ctgagccaag gagctggtag ttacgttgtc cgcaatggat aa. It is sometimes possible for the material contained within the vial of "TCN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.