Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FAM105A cdna clone

FAM105A cDNA Clone

Gene Names
FAM105A; NET20
Synonyms
FAM105A; FAM105A cDNA Clone; FAM105A cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgacaaggagccccacgcgggcaagggagcgggagcggtctggcgctcccgccgcaggaagtgaccaagttcactcctggatgctagctacaagccaagccttagacactgtctggagaatggcaaaaggctttgtgatgttggcagtttcatttctggtggctgccatctgctacttccggaggctacatttatattcagggcacaagctgaaatggtggattggatatctgcagagaaaattcaaaaggaacctcagtgtggaggcagaggttgatttactcagttattgtgcaagagaatggaaaggagagacaccccgtaacaagctgatgaggaaggcttatgaggagctattttggcggcatcacattaaatgtgttcgacaagtaaggagagataactatgatgctctcagatcagtgttatttcagatattcagccagggcatctcttttccatcatggatgaaagaaaaggacattgttaagcttcctgaaaaactgctgttttcacaaggttgtaattggattcagcagtacagttttggtcctgagaagtatacaggctcgaatgtgtttggaaaactacggaaatatgtggaattattgaaaacacagtggactgaatttaatggcattagagattatcacaagagaggaagtatgtgcaacacccttttttcagatgccattctggaatataaactttatgaagctttaaagttcatcatgctgtatcaagtcactgaagtttatgaacaaatgaagactaaaaaggtcattcccagtctttttagactcctgttttccagggagacatcctctgatcctttgagcttcatgatgaatcacctgaattctgtaggcgacacatgtggactagagcagattgatatgtttatacttggatactcccttgaagtaaagataaaagtgttcagactgttcaagtttaactccagagactttgaagtctgctacccagaggagcctctcagggactggccggagatctccctgctgaccgagaacgaccgccactaccacattccagtcttttaa
Sequence Length
1071
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,196 Da
NCBI Official Full Name
Homo sapiens family with sequence similarity 105, member A, mRNA
NCBI Official Synonym Full Names
family with sequence similarity 105 member A
NCBI Official Symbol
FAM105A
NCBI Official Synonym Symbols
NET20
NCBI Protein Information
inactive ubiquitin thioesterase FAM105A
UniProt Protein Name
Inactive ubiquitin thioesterase FAM105A
UniProt Gene Name
FAM105A
UniProt Entry Name
F105A_HUMAN

Uniprot Description

FAM105A: Belongs to the FAM105 family.

Chromosomal Location of Human Ortholog: 5p15.2

Similar Products

Product Notes

The FAM105A fam105a (Catalog #AAA1275724) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcga caaggagccc cacgcgggca agggagcggg agcggtctgg cgctcccgcc gcaggaagtg accaagttca ctcctggatg ctagctacaa gccaagcctt agacactgtc tggagaatgg caaaaggctt tgtgatgttg gcagtttcat ttctggtggc tgccatctgc tacttccgga ggctacattt atattcaggg cacaagctga aatggtggat tggatatctg cagagaaaat tcaaaaggaa cctcagtgtg gaggcagagg ttgatttact cagttattgt gcaagagaat ggaaaggaga gacaccccgt aacaagctga tgaggaaggc ttatgaggag ctattttggc ggcatcacat taaatgtgtt cgacaagtaa ggagagataa ctatgatgct ctcagatcag tgttatttca gatattcagc cagggcatct cttttccatc atggatgaaa gaaaaggaca ttgttaagct tcctgaaaaa ctgctgtttt cacaaggttg taattggatt cagcagtaca gttttggtcc tgagaagtat acaggctcga atgtgtttgg aaaactacgg aaatatgtgg aattattgaa aacacagtgg actgaattta atggcattag agattatcac aagagaggaa gtatgtgcaa cacccttttt tcagatgcca ttctggaata taaactttat gaagctttaa agttcatcat gctgtatcaa gtcactgaag tttatgaaca aatgaagact aaaaaggtca ttcccagtct ttttagactc ctgttttcca gggagacatc ctctgatcct ttgagcttca tgatgaatca cctgaattct gtaggcgaca catgtggact agagcagatt gatatgttta tacttggata ctcccttgaa gtaaagataa aagtgttcag actgttcaag tttaactcca gagactttga agtctgctac ccagaggagc ctctcaggga ctggccggag atctccctgc tgaccgagaa cgaccgccac taccacattc cagtctttta a. It is sometimes possible for the material contained within the vial of "FAM105A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.