Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM5 cdna clone

TRIM5 cDNA Clone

Gene Names
TRIM5; RNF88; TRIM5alpha
Synonyms
TRIM5; TRIM5 cDNA Clone; TRIM5 cdna clone
Ordering
For Research Use Only!
Sequence
atggcttctggaatcctggttaatgtaaaggaggaggtgacctgccccatctgcctggaactcctgacacaacccctgagcctggactgcggccacagcttctgccaagcatgcctcactgcaaaccacaagaagtccatgctagacaaaggagagagtagctgccctgtgtgccggatcagttaccagcctgagaacatacggcctaatcggcatgtagccaacatagtggagaagctcagggaggtcaagttgagcccagaggggcagaaagttgatcattgtgcacgccatggagagaaacttctactcttctgtcaggaggacgggaaggtcatttgctggctttgtgagcggtctcaggagcaccgtggtcaccacacgttcctcacagaggaggttgcccgggagtaccaagtgaagctccaggcagctctggagatgctgaggcagaagcagcaggaagctgaagagttggaagctgacatcagagaagagaaagcttcctggaagactcaaatacagtatgacaaaaccaacgtcttggcagattttgagcaactgagagacatcctggactgggaggagagcaatgagctgcaaaacctggagaaggaggaggaagacattctgaaaagccttacgaactctgaaactgagatggtgcagcagacccagtccctgagagagctcatctcagatctggagcatcggctgcaggggtcagtgatggagctgcttcagggtgtggatggcgtcataaaaaggacggagaacgtgaccttgaagaagccagaaacttttccaaaaaatcaaaggagagtgtttcgagctcctgatctgaaaggaatgctagaagtgtttagagagctgacagatgtccgacgctactggggtaaggagaagtcacattatcataagccaccctgcggcttatcattattattatctttatcttttagaattttatgttctctattaggctcatgttttaagatttatgattctccttccaagacacacataacttacccctccttataa
Sequence Length
1044
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,677 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 5, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 5
NCBI Official Symbol
TRIM5
NCBI Official Synonym Symbols
RNF88; TRIM5alpha
NCBI Protein Information
tripartite motif-containing protein 5
UniProt Protein Name
Tripartite motif-containing protein 5
UniProt Gene Name
TRIM5
UniProt Synonym Gene Names
RNF88
UniProt Entry Name
TRIM5_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The protein forms homo-oligomers via the coilel-coil region and localizes to cytoplasmic bodies. It appears to function as a E3 ubiquitin-ligase and ubiqutinates itself to regulate its subcellular localization. It may play a role in retroviral restriction. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Dec 2009]

Uniprot Description

TRIM5: Isoform Alpha is a retrovirus restriction factor, which mediates species-specific, early block to retrovirus infection. Targets retroviral capsid soon after entry into the cell, and prevents reverse transcription of the virus RNA genome. Isoform Alpha trimers may make multiple contacts with the hexameric lattice of CA proteins which constitute the surface of retrovirion core, and somehow inactivate the virus. Restricts efficiently infection by N-MLV, but not HIV-1. May have E3 ubiquitin-protein ligase activity. Belongs to the TRIM/RBCC family. 6 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Ligase; EC 6.3.2.-; EC 6.3.2.19; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 11p15

Cellular Component: cytoplasm; cytosol

Molecular Function: identical protein binding; pattern recognition receptor activity; protein binding; protein binding, bridging; protein homodimerization activity; protein kinase binding; ubiquitin-protein ligase activity

Biological Process: activation of innate immune response; activation of NF-kappaB transcription factor; autophagy; defense response to virus; innate immune response; negative regulation of virion penetration into host cell; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of MAPKKK cascade; positive regulation of transcription factor activity; regulation of lipopolysaccharide-mediated signaling pathway; regulation of protein localization

Research Articles on TRIM5

Similar Products

Product Notes

The TRIM5 trim5 (Catalog #AAA1275704) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcttctg gaatcctggt taatgtaaag gaggaggtga cctgccccat ctgcctggaa ctcctgacac aacccctgag cctggactgc ggccacagct tctgccaagc atgcctcact gcaaaccaca agaagtccat gctagacaaa ggagagagta gctgccctgt gtgccggatc agttaccagc ctgagaacat acggcctaat cggcatgtag ccaacatagt ggagaagctc agggaggtca agttgagccc agaggggcag aaagttgatc attgtgcacg ccatggagag aaacttctac tcttctgtca ggaggacggg aaggtcattt gctggctttg tgagcggtct caggagcacc gtggtcacca cacgttcctc acagaggagg ttgcccggga gtaccaagtg aagctccagg cagctctgga gatgctgagg cagaagcagc aggaagctga agagttggaa gctgacatca gagaagagaa agcttcctgg aagactcaaa tacagtatga caaaaccaac gtcttggcag attttgagca actgagagac atcctggact gggaggagag caatgagctg caaaacctgg agaaggagga ggaagacatt ctgaaaagcc ttacgaactc tgaaactgag atggtgcagc agacccagtc cctgagagag ctcatctcag atctggagca tcggctgcag gggtcagtga tggagctgct tcagggtgtg gatggcgtca taaaaaggac ggagaacgtg accttgaaga agccagaaac ttttccaaaa aatcaaagga gagtgtttcg agctcctgat ctgaaaggaa tgctagaagt gtttagagag ctgacagatg tccgacgcta ctggggtaag gagaagtcac attatcataa gccaccctgc ggcttatcat tattattatc tttatctttt agaattttat gttctctatt aggctcatgt tttaagattt atgattctcc ttccaagaca cacataactt acccctcctt ataa. It is sometimes possible for the material contained within the vial of "TRIM5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.