Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MAGEC2 cdna clone

MAGEC2 cDNA Clone

Gene Names
MAGEC2; CT10; HCA587; MAGEE1
Synonyms
MAGEC2; MAGEC2 cDNA Clone; MAGEC2 cdna clone
Ordering
For Research Use Only!
Sequence
atgcctcccgttccaggcgttccattccgcaacgttgacaacgactccccgacctcagttgagttagaagactgggtagatgcacagcatcccacagatgaggaagaggaggaagcctcctccgcctcttccactttgtacttagtattttccccctcttctttctccacatcctcttctctgattcttggtggtcctgaggaggaggaggtgccctctggtgtgataccaaatcttaccgagagcattcccagtagtcctccacagggtcctccacagggtccttcccagagtcctctgagctcctgctgctcctctttttcatggagctcattcagtgaggagtccagcagccagaaaggggaggatacaggcacctgtcagggcctgccagacagtgagtcctctttcacatatacactagatgaaaaggtggccgagttagtggagttcctgctcctcaaatacgaagcagaggagcctgtaacagaggcagagatgctgatgattgtcatcaagtacaaagattactttcctgtgatactcaagagagcccgtgagttcatggagcttctttttggccttgccctgatagaagtgggccctgaccacttctgtgtgtttgcaaacacagtaggcctcaccgatgagggtagtgatgatgagggcatgcccgagaacagcctcctgattattattctgagtgtgatcttcataaagggcaactgtgcctctgaggaggtcatctgggaagtgctgaatgcagtaggggtatatgctgggagggagcacttcgtctatggggagcctagggagctcctcactaaagtttgggtgcagggacattacctggagtatcgggaggtgccccacagttctcctccatattatgaattcctgtggggtccaagagcccattcagaaagcatcaagaagaaagtactagagtttttagccaagctgaacaacactgttcctagttcctttccatcctggtacaaggatgctttgaaagatgtggaagagagagtccaggccacaattgataccgcagatgatgccactgtcatggccagtgaaagcctcagtgtcatgtccagcaacgtctccttttctgagtga
Sequence Length
1122
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,163 Da
NCBI Official Full Name
Homo sapiens melanoma antigen family C, 2, mRNA
NCBI Official Synonym Full Names
MAGE family member C2
NCBI Official Symbol
MAGEC2
NCBI Official Synonym Symbols
CT10; HCA587; MAGEE1
NCBI Protein Information
melanoma-associated antigen C2
UniProt Protein Name
Melanoma-associated antigen C2
UniProt Gene Name
MAGEC2
UniProt Synonym Gene Names
HCA587; MAGEE1; CT10
UniProt Entry Name
MAGC2_HUMAN

NCBI Description

This gene is a member of the MAGEC gene family. It is not expressed in normal tissues, except for testis, and is expressed in tumors of various histological types. This gene and the other MAGEC genes are clustered on chromosome Xq26-q27. [provided by RefSeq, Oct 2009]

Uniprot Description

MAGE-C2: Proposed to enhance ubiquitin ligase activity of RING- type zinc finger-containing E3 ubiquitin-protein ligases. In vitro enhances ubiquitin ligase activity of TRIM28 and stimulates p53/TP53 ubiquitination in presence of Ubl-conjugating enzyme UBE2H leading to p53/TP53 degradation. Proposed to act through recruitment and/or stabilization of the Ubl-conjugating enzymes (E2) at the E3:substrate complex.

Protein type: Cancer Testis Antigen (CTA)

Chromosomal Location of Human Ortholog: Xq27

Cellular Component: cytoplasm; nucleus

Molecular Function: protein binding; ubiquitin protein ligase binding

Biological Process: cellular protein catabolic process; positive regulation of ubiquitin-protein ligase activity

Research Articles on MAGEC2

Similar Products

Product Notes

The MAGEC2 magec2 (Catalog #AAA1275639) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcctcccg ttccaggcgt tccattccgc aacgttgaca acgactcccc gacctcagtt gagttagaag actgggtaga tgcacagcat cccacagatg aggaagagga ggaagcctcc tccgcctctt ccactttgta cttagtattt tccccctctt ctttctccac atcctcttct ctgattcttg gtggtcctga ggaggaggag gtgccctctg gtgtgatacc aaatcttacc gagagcattc ccagtagtcc tccacagggt cctccacagg gtccttccca gagtcctctg agctcctgct gctcctcttt ttcatggagc tcattcagtg aggagtccag cagccagaaa ggggaggata caggcacctg tcagggcctg ccagacagtg agtcctcttt cacatataca ctagatgaaa aggtggccga gttagtggag ttcctgctcc tcaaatacga agcagaggag cctgtaacag aggcagagat gctgatgatt gtcatcaagt acaaagatta ctttcctgtg atactcaaga gagcccgtga gttcatggag cttctttttg gccttgccct gatagaagtg ggccctgacc acttctgtgt gtttgcaaac acagtaggcc tcaccgatga gggtagtgat gatgagggca tgcccgagaa cagcctcctg attattattc tgagtgtgat cttcataaag ggcaactgtg cctctgagga ggtcatctgg gaagtgctga atgcagtagg ggtatatgct gggagggagc acttcgtcta tggggagcct agggagctcc tcactaaagt ttgggtgcag ggacattacc tggagtatcg ggaggtgccc cacagttctc ctccatatta tgaattcctg tggggtccaa gagcccattc agaaagcatc aagaagaaag tactagagtt tttagccaag ctgaacaaca ctgttcctag ttcctttcca tcctggtaca aggatgcttt gaaagatgtg gaagagagag tccaggccac aattgatacc gcagatgatg ccactgtcat ggccagtgaa agcctcagtg tcatgtccag caacgtctcc ttttctgagt ga. It is sometimes possible for the material contained within the vial of "MAGEC2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.