Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CHRNA7 cdna clone

CHRNA7 cDNA Clone

Gene Names
CHRNA7; NACHRA7; CHRNA7-2
Synonyms
CHRNA7; CHRNA7 cDNA Clone; CHRNA7 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaggaggcagatatcagtggctatatccccaatggagaatgggacctagtgggaatccccggcaagaggagtgaaaggttctatgagtgctgcaaagagccctaccccgatgtcaccttcacagtgaccatgcgccgcaggacgctctactatggcctcaacctgctgatcccctgtgtgctcatctccgccctcgccctgctggtgttcctgcttcctgcagattccggggagaagatttccctggggataacagtcttactctctcttaccgtcttcatgctgctcgtggctgagatcatgcccgcaacatccgattcggtaccattgatagcccagtacttcgccagcaccatgatcatcgtgggcctctcggtggtggtgacagtgatcgtgctgcagtaccaccaccacgaccccgacgggggcaagatgcccaagtggaccagagtcatccttctgaactggtgcgcgtggttcctgcgaatgaagaggcccggggaggacaaggtgcgcccggcctgccagcacaagcagcggcgctgcagcctggccagtgtggagatgagcgccgtggcgccgccgcccgccagcaacgggaacctgctgtacatcggcttccgcggcctggacggcgtgcactgtgtcccgacccccgactctggggtagtgtgtggccgcatggcctgctcccccacgcacgatgagcacctcctgcacggtgggcaaccccccgagggggacccggacttggccaagatcctggaggaggtccgctacattgccaaccgcttccgctgccaggacgaaagcgaggcggtctgcagcgagtggaagttcgccgcctgtgtggtggaccgcctgtgcctcatggccttctcggtcttcaccatcatctgcaccatcggcatcctgatgtcggctcccaacttcgtggaggccgtgtccaaagactttgcgtaa
Sequence Length
966
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
11,485 Da
NCBI Official Full Name
Homo sapiens cholinergic receptor, nicotinic, alpha 7, mRNA
NCBI Official Synonym Full Names
cholinergic receptor nicotinic alpha 7 subunit
NCBI Official Symbol
CHRNA7
NCBI Official Synonym Symbols
NACHRA7; CHRNA7-2
NCBI Protein Information
neuronal acetylcholine receptor subunit alpha-7
UniProt Protein Name
Neuronal acetylcholine receptor subunit alpha-7
UniProt Gene Name
CHRNA7
UniProt Synonym Gene Names
NACHRA7
UniProt Entry Name
ACHA7_HUMAN

NCBI Description

The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]

Uniprot Description

nAChRA7: After binding acetylcholine, the AChR responds by an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. The channel is blocked by alpha-bungarotoxin. Belongs to the ligand-gated ion channel (TC 1.A.9) family. Acetylcholine receptor (TC 1.A.9.1) subfamily. Alpha- 7/CHRNA7 sub-subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Channel, ligand-gated; Membrane protein, integral; Channel, cation

Chromosomal Location of Human Ortholog: 15q14

Cellular Component: nicotinic acetylcholine-gated receptor-channel complex; plasma membrane

Molecular Function: acetylcholine binding; acetylcholine receptor activity; acetylcholine-gated cation channel activity; beta-amyloid binding; chloride channel regulator activity; ligand-gated ion channel activity; nicotinic acetylcholine-activated cation-selective channel activity; protein homodimerization activity; toxin binding

Biological Process: activation of MAPK activity; calcium ion transport; cellular calcium ion homeostasis; cognition; negative regulation of tumor necrosis factor production; positive regulation of angiogenesis; positive regulation of cell proliferation; response to hypoxia; response to nicotine; signal transduction; synaptic transmission, cholinergic

Disease: Chromosome 15q13.3 Deletion Syndrome

Research Articles on CHRNA7

Similar Products

Product Notes

The CHRNA7 chrna7 (Catalog #AAA1275619) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaggagg cagatatcag tggctatatc cccaatggag aatgggacct agtgggaatc cccggcaaga ggagtgaaag gttctatgag tgctgcaaag agccctaccc cgatgtcacc ttcacagtga ccatgcgccg caggacgctc tactatggcc tcaacctgct gatcccctgt gtgctcatct ccgccctcgc cctgctggtg ttcctgcttc ctgcagattc cggggagaag atttccctgg ggataacagt cttactctct cttaccgtct tcatgctgct cgtggctgag atcatgcccg caacatccga ttcggtacca ttgatagccc agtacttcgc cagcaccatg atcatcgtgg gcctctcggt ggtggtgaca gtgatcgtgc tgcagtacca ccaccacgac cccgacgggg gcaagatgcc caagtggacc agagtcatcc ttctgaactg gtgcgcgtgg ttcctgcgaa tgaagaggcc cggggaggac aaggtgcgcc cggcctgcca gcacaagcag cggcgctgca gcctggccag tgtggagatg agcgccgtgg cgccgccgcc cgccagcaac gggaacctgc tgtacatcgg cttccgcggc ctggacggcg tgcactgtgt cccgaccccc gactctgggg tagtgtgtgg ccgcatggcc tgctccccca cgcacgatga gcacctcctg cacggtgggc aaccccccga gggggacccg gacttggcca agatcctgga ggaggtccgc tacattgcca accgcttccg ctgccaggac gaaagcgagg cggtctgcag cgagtggaag ttcgccgcct gtgtggtgga ccgcctgtgc ctcatggcct tctcggtctt caccatcatc tgcaccatcg gcatcctgat gtcggctccc aacttcgtgg aggccgtgtc caaagacttt gcgtaa. It is sometimes possible for the material contained within the vial of "CHRNA7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.