FCER2 cdna clone
FCER2 cDNA Clone
Gene Names
FCER2; CD23; FCE2; CD23A; IGEBF; CLEC4J; BLAST-2
Synonyms
FCER2; FCER2 cDNA Clone; FCER2 cdna clone
Sequence
atggaggaaggtcaatattcagagatcgaggagcttcccaggaggcggtgttgcaggcgtgggactcagatcgtgctgctggggctggtgaccgccgctctgtgggctgggctgctgactctgcttctcctgtggcactgggacaccacacagagtctaaaacagctggaagagagggctgcccggaacgtctctcaagtttccaagaacttggaaagccaccacggtgaccagatggcgcagaaatcccagtccacgcagatttcacaggaactggaggaacttcgagctgaacagcagagattgaaatctcaggacttggagctgtcctggaacctgaacgggcttcaagcagatctgagcagcttcaagtcccaggaattgaacgagaggaacgaagcttcagatttgctggaaagactccgggaggaggtgacaaagctaaggatggagttgcaggtgtccagcggctttgtgtgcaacacgtgccctgaaaagtggatcaatttccaacggaagtgctactacttcggcaagggcaccaagcagtgggtccacgcccggtatgcctgtgacgacatggaagggcagctggtcagcatccacagcccggaggagcaggacttcctgaccaagcatgccagccacaccggctcctggattggccttcggaacttggacctgaagggggagtttatctgggtggatgggagccacgtggactacagcaactgggctccaggggagcccaccagccggagccagggcgaggactgcgtgatgatgcggggctccggtcgctggaacgacgccttctgcgaccgtaagctgggcgcctgggtgtgcgaccggctggccacatgcacgccgccagccagcgaaggttccgcggagtccatgggacctgattcaagaccagaccctgacggccgcctgcccaccccctctgcccctctccactcttga
Sequence Length
966
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
36,469 Da
NCBI Official Full Name
Homo sapiens Fc fragment of IgE, low affinity II, receptor for (CD23), mRNA
NCBI Official Synonym Full Names
Fc fragment of IgE receptor II
NCBI Official Symbol
FCER2
NCBI Official Synonym Symbols
CD23; FCE2; CD23A; IGEBF; CLEC4J; BLAST-2
NCBI Protein Information
low affinity immunoglobulin epsilon Fc receptor
UniProt Protein Name
Low affinity immunoglobulin epsilon Fc receptor
Protein Family
UniProt Gene Name
FCER2
UniProt Synonym Gene Names
CD23A; CLEC4J; FCE2; IGEBF
UniProt Entry Name
FCER2_HUMAN
NCBI Description
The protein encoded by this gene is a B-cell specific antigen, and a low-affinity receptor for IgE. It has essential roles in B cell growth and differentiation, and the regulation of IgE production. This protein also exists as a soluble secreted form, then functioning as a potent mitogenic growth factor. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
Uniprot Description
Low-affinity receptor for immunoglobulin E (IgE) and CR2/CD21. Has essential roles in the regulation of IgE production and in the differentiation of B-cells (it is a B-cell-specific antigen).
Research Articles on FCER2
Similar Products
Product Notes
The FCER2 fcer2 (Catalog #AAA1275609) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggaag gtcaatattc agagatcgag gagcttccca ggaggcggtg ttgcaggcgt gggactcaga tcgtgctgct ggggctggtg accgccgctc tgtgggctgg gctgctgact ctgcttctcc tgtggcactg ggacaccaca cagagtctaa aacagctgga agagagggct gcccggaacg tctctcaagt ttccaagaac ttggaaagcc accacggtga ccagatggcg cagaaatccc agtccacgca gatttcacag gaactggagg aacttcgagc tgaacagcag agattgaaat ctcaggactt ggagctgtcc tggaacctga acgggcttca agcagatctg agcagcttca agtcccagga attgaacgag aggaacgaag cttcagattt gctggaaaga ctccgggagg aggtgacaaa gctaaggatg gagttgcagg tgtccagcgg ctttgtgtgc aacacgtgcc ctgaaaagtg gatcaatttc caacggaagt gctactactt cggcaagggc accaagcagt gggtccacgc ccggtatgcc tgtgacgaca tggaagggca gctggtcagc atccacagcc cggaggagca ggacttcctg accaagcatg ccagccacac cggctcctgg attggccttc ggaacttgga cctgaagggg gagtttatct gggtggatgg gagccacgtg gactacagca actgggctcc aggggagccc accagccgga gccagggcga ggactgcgtg atgatgcggg gctccggtcg ctggaacgac gccttctgcg accgtaagct gggcgcctgg gtgtgcgacc ggctggccac atgcacgccg ccagccagcg aaggttccgc ggagtccatg ggacctgatt caagaccaga ccctgacggc cgcctgccca ccccctctgc ccctctccac tcttga. It is sometimes possible for the material contained within the vial of "FCER2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
