Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX41 cdna clone

DDX41 cDNA Clone

Gene Names
DDX41; ABS; MPLPF
Synonyms
DDX41; DDX41 cDNA Clone; DDX41 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagtcggaacccgaacggaagcgggctcgcaccgacgaggtgcctgccggaggaagccgctccgaggcggaagatgaggacgacgaggactacgtgccctatgtgccgttacggcagcgccggcagctactgctccagaagctgctgcagcgaagacgcaagggagctgcggaggaagagcagcaggacagcggtagtgaaccccggggagatgaggacgacatcccgctaggccctcagtccaacgtcagcctcctggatcagcaccagcaccttaaagagaaggctgaagcgcgcaaagagtctgccaaggagaagcagctgaaggaagaagagaagatcctggagagtgttgccgagggccgagcattgatgtcagtgaaggagatggctaagggcattacgtatgatgaccccatcaaaaccagctggactccaccccgttatgttctgagcatgtctgaagagcgacatgagcgcgtgcggaagaaataccacatcctggtggagggagacggtatcccaccacccatcaagagcttcaaggaaatgaagtttcctgcagccatcctgagaggcctgaagaagaaaggcattcaccacccaacacccattcagatccagggcatccccaccattctatctggccgtgacatgataggcatcgctttcacgggttcaggcaagacactggtgttcacgttgcccgtcatcatgttctgcctggaacaagagaagaggttacccttctcaaagcgcgaggggccctatggactcatcatctgcccctcgcgggagctggcccggcagacccatggcatcctggagtactactgccgcctgctgcaggaggacagctcaccactcctgcgctgcgccctctgcattgggggcatgtccgtgaaagagcagatggagaccatccgacacggtgtacacatgatggtggccaccccggggcgcctcatggatttgctgcagaagaagatggtcagcctagacatctgtcgctacctggccctggacgaggctgaccgcatgatcgacatgggcttcgagggtgacatccgtaccatcttctcctacttcaagggccagcgacagaccctgctcttcagtgccaccatgccgaagaagattcagaactttgctaagagtgcccttgtaaagcctgtgaccatcaatgtggggcgcgctggggctgccagcctggatgtcatccaggaggtagaatatgtgaaggaggaggccaagatggtgtacctgctcgagtgcctgcagaagacacccccgcctgtactcatctttgcagagaagaaggcagacgtggacgccatccacgagtacctgctgctcaagggggttgaggccgtagccatccatgggggcaaagaccaggaggaacggactaaggccatcgaggcattccgggagggcaagaaggatgtcctagtagccacagacgttgcctccaagggcctggacttccctgccatccagcacgtcatcaattatgacatgccagaggagattgagaactatgtacaccggattggccgcaccgggcgctcgggaaacacaggcatcgccactaccttcatcaacaaagcgtgtgatgagtcagtgctgatggacctcaaagcgctgctgctagaagccaagcagaaggtgccgcccgtgctgcaggtgctgcattgcggggatgagtccatgctggacattggaggagagcgcggctgtgccttctgcgggggcctgggtcatcggatcactgactgccccaaactcgaggctatgcagaccaagcaggtcagcaacatcggtcgcaaggactacctggcccacagctccatggacttctga
Sequence Length
1869
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,838 Da
NCBI Official Full Name
Homo sapiens DEAD (Asp-Glu-Ala-Asp) box polypeptide 41, mRNA
NCBI Official Synonym Full Names
DEAD-box helicase 41
NCBI Official Symbol
DDX41
NCBI Official Synonym Symbols
ABS; MPLPF
NCBI Protein Information
probable ATP-dependent RNA helicase DDX41
UniProt Protein Name
Probable ATP-dependent RNA helicase DDX41
UniProt Gene Name
DDX41
UniProt Synonym Gene Names
ABS
UniProt Entry Name
DDX41_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure, such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of the DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Based on studies in Drosophila, the abstrakt gene is widely required during post-transcriptional gene expression. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX41: Probable ATP-dependent RNA helicase. Is required during post-transcriptional gene expression. May be involved in pre-mRNA splicing. Belongs to the DEAD box helicase family. DDX41 subfamily.

Protein type: RNA-binding; RNA splicing; Helicase; Spliceosome; EC 3.6.4.13

Chromosomal Location of Human Ortholog: 5q35.3

Cellular Component: cytosol; membrane; nucleus; spliceosome

Molecular Function: ATP-dependent RNA helicase activity; protein binding

Biological Process: apoptosis; cell differentiation; cell proliferation; nuclear mRNA splicing, via spliceosome; positive regulation of interferon type I production; regulation of interferon type I production; RNA secondary structure unwinding

Disease: Myeloproliferative/lymphoproliferative Neoplasms, Familial (multiple Types), Susceptibility To

Research Articles on DDX41

Similar Products

Product Notes

The DDX41 ddx41 (Catalog #AAA1275593) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggagt cggaacccga acggaagcgg gctcgcaccg acgaggtgcc tgccggagga agccgctccg aggcggaaga tgaggacgac gaggactacg tgccctatgt gccgttacgg cagcgccggc agctactgct ccagaagctg ctgcagcgaa gacgcaaggg agctgcggag gaagagcagc aggacagcgg tagtgaaccc cggggagatg aggacgacat cccgctaggc cctcagtcca acgtcagcct cctggatcag caccagcacc ttaaagagaa ggctgaagcg cgcaaagagt ctgccaagga gaagcagctg aaggaagaag agaagatcct ggagagtgtt gccgagggcc gagcattgat gtcagtgaag gagatggcta agggcattac gtatgatgac cccatcaaaa ccagctggac tccaccccgt tatgttctga gcatgtctga agagcgacat gagcgcgtgc ggaagaaata ccacatcctg gtggagggag acggtatccc accacccatc aagagcttca aggaaatgaa gtttcctgca gccatcctga gaggcctgaa gaagaaaggc attcaccacc caacacccat tcagatccag ggcatcccca ccattctatc tggccgtgac atgataggca tcgctttcac gggttcaggc aagacactgg tgttcacgtt gcccgtcatc atgttctgcc tggaacaaga gaagaggtta cccttctcaa agcgcgaggg gccctatgga ctcatcatct gcccctcgcg ggagctggcc cggcagaccc atggcatcct ggagtactac tgccgcctgc tgcaggagga cagctcacca ctcctgcgct gcgccctctg cattgggggc atgtccgtga aagagcagat ggagaccatc cgacacggtg tacacatgat ggtggccacc ccggggcgcc tcatggattt gctgcagaag aagatggtca gcctagacat ctgtcgctac ctggccctgg acgaggctga ccgcatgatc gacatgggct tcgagggtga catccgtacc atcttctcct acttcaaggg ccagcgacag accctgctct tcagtgccac catgccgaag aagattcaga actttgctaa gagtgccctt gtaaagcctg tgaccatcaa tgtggggcgc gctggggctg ccagcctgga tgtcatccag gaggtagaat atgtgaagga ggaggccaag atggtgtacc tgctcgagtg cctgcagaag acacccccgc ctgtactcat ctttgcagag aagaaggcag acgtggacgc catccacgag tacctgctgc tcaagggggt tgaggccgta gccatccatg ggggcaaaga ccaggaggaa cggactaagg ccatcgaggc attccgggag ggcaagaagg atgtcctagt agccacagac gttgcctcca agggcctgga cttccctgcc atccagcacg tcatcaatta tgacatgcca gaggagattg agaactatgt acaccggatt ggccgcaccg ggcgctcggg aaacacaggc atcgccacta ccttcatcaa caaagcgtgt gatgagtcag tgctgatgga cctcaaagcg ctgctgctag aagccaagca gaaggtgccg cccgtgctgc aggtgctgca ttgcggggat gagtccatgc tggacattgg aggagagcgc ggctgtgcct tctgcggggg cctgggtcat cggatcactg actgccccaa actcgaggct atgcagacca agcaggtcag caacatcggt cgcaaggact acctggccca cagctccatg gacttctga. It is sometimes possible for the material contained within the vial of "DDX41, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.