Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MYL2 cdna clone

MYL2 cDNA Clone

Gene Names
MYL2; MLC2; CMH10; MLC-2s/v
Synonyms
MYL2; MYL2 cDNA Clone; MYL2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcacctaagaaagcaaagaagagagccgggggcgccaactccaacgtgttctccatgttcgaacagacccaaatccaggaatttaaggaggccttcactatcatggaccagaacagggatggcttcattgacaagaacgatctgagagacacctttgctgcccttgggcgagtgaacgtgaaaaatgaagaaattgatgaaatgatcaaggaggctccgggtccaattaactttactgtgttcctcacaatgtttggggagaaacttaagggagcggaccctgaggaaaccattctcaacgcattcaaagtgtttgaccctgaaggcaaaggggtgctgaaggctgattacgttcgggaaatgctgaccacgcaggcggagaggttttccaaggaggaggttgaccagatgttcgccgccttcccccctgacgtgactggcaacttggactacaagaacctggtgcacatcatcacccacggagaagagaaggactag
Sequence Length
501
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,789 Da
NCBI Official Full Name
Homo sapiens myosin, light chain 2, regulatory, cardiac, slow, mRNA
NCBI Official Synonym Full Names
myosin light chain 2
NCBI Official Symbol
MYL2
NCBI Official Synonym Symbols
MLC2; CMH10; MLC-2s/v
NCBI Protein Information
myosin regulatory light chain 2, ventricular/cardiac muscle isoform
UniProt Protein Name
Myosin regulatory light chain 2, ventricular/cardiac muscle isoform
Protein Family
UniProt Gene Name
MYL2
UniProt Synonym Gene Names
MLC-2s/v
UniProt Entry Name
MLRV_HUMAN

NCBI Description

Thus gene encodes the regulatory light chain associated with cardiac myosin beta (or slow) heavy chain. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in this gene are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy. [provided by RefSeq, Jul 2008]

Uniprot Description

MRLC2V: myosin regulatory light chain 2, ventricular/cardiac muscle isoform. Ca+ triggers the phosphorylation of regulatory light chain that in turn triggers contraction. Mutations in MYL2 are associated with mid-left ventricular chamber type hypertrophic cardiomyopathy.

Protein type: Contractile

Chromosomal Location of Human Ortholog: 12q24.11

Cellular Component: actin cytoskeleton; cytoskeleton; cytosol; myosin complex; sarcomere

Molecular Function: actin monomer binding; calcium ion binding; protein binding

Biological Process: cardiac myofibril assembly; heart contraction; heart development; muscle filament sliding; negative regulation of cell growth; regulation of striated muscle contraction; regulation of the force of heart contraction; ventricular cardiac muscle morphogenesis

Disease: Cardiomyopathy, Familial Hypertrophic, 10

Research Articles on MYL2

Similar Products

Product Notes

The MYL2 myl2 (Catalog #AAA1275589) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaccta agaaagcaaa gaagagagcc gggggcgcca actccaacgt gttctccatg ttcgaacaga cccaaatcca ggaatttaag gaggccttca ctatcatgga ccagaacagg gatggcttca ttgacaagaa cgatctgaga gacacctttg ctgcccttgg gcgagtgaac gtgaaaaatg aagaaattga tgaaatgatc aaggaggctc cgggtccaat taactttact gtgttcctca caatgtttgg ggagaaactt aagggagcgg accctgagga aaccattctc aacgcattca aagtgtttga ccctgaaggc aaaggggtgc tgaaggctga ttacgttcgg gaaatgctga ccacgcaggc ggagaggttt tccaaggagg aggttgacca gatgttcgcc gccttccccc ctgacgtgac tggcaacttg gactacaaga acctggtgca catcatcacc cacggagaag agaaggacta g. It is sometimes possible for the material contained within the vial of "MYL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.