Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GGCT cdna clone

GGCT cDNA Clone

Gene Names
GGCT; GGC; GCTG; CRF21; C7orf24
Synonyms
GGCT; GGCT cDNA Clone; GGCT cdna clone
Ordering
For Research Use Only!
Sequence
atggccaactcgggctgcaaggacgtcacgggtccagatgaggagagttttctgtactttgcctacggcagcaacctgctgacagagaggatccacctccgaaacccctcggcggcgttcttctgtgtggcccgcctgcaggattttaagcttgactttggcaattcccaaggcaaaacaagtcaaacttggcatggagggatagccaccatttttcagagtcctggcgatgaagtgtggggagtagtatggaaaatgaacaaaagcaatttaaattctctggatgagcaagaaggggttaaaagtggaatgtatgttgtaatagaagttaaagttgcaactcaagaaggaaaagaaataacctgtcgaagttatctgatgacaaattacgaaagtgctcccccatccccacagtataaaaagattatttgcatgggtgcaaaagaaaatggtttgccgctggagtatcaagagaagttaaaagcaatagaaccaaatgactatacaggaaaggtctcagaagaaattgaagacatcatcaaaaagggggaaacacaaactctttag
Sequence Length
567
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,092 Da
NCBI Official Full Name
Homo sapiens gamma-glutamyl cyclotransferase, mRNA
NCBI Official Synonym Full Names
gamma-glutamylcyclotransferase
NCBI Official Symbol
GGCT
NCBI Official Synonym Symbols
GGC; GCTG; CRF21; C7orf24
NCBI Protein Information
gamma-glutamylcyclotransferase
UniProt Protein Name
Gamma-glutamylcyclotransferase
UniProt Gene Name
GGCT
UniProt Synonym Gene Names
C7orf24; CRF21
UniProt Entry Name
GGCT_HUMAN

NCBI Description

The protein encoded by this gene catalyzes the formation of 5-oxoproline from gamma-glutamyl dipeptides, the penultimate step in glutathione catabolism, and may play a critical role in glutathione homeostasis. The encoded protein may also play a role in cell proliferation, and the expression of this gene is a potential marker for cancer. Pseudogenes of this gene are located on the long arm of chromosome 5 and the short arm of chromosomes 2 and 20. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]

Uniprot Description

GGCT: Catalyzes the formation of 5-oxoproline from gamma- glutamyl dipeptides and may play a significant role in glutathione homeostasis. Induces release of cytochrome c from mitochondria with resultant induction of apoptosis. Belongs to the gamma-glutamylcyclotransferase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transferase; EC 2.3.2.4; Apoptosis; Other Amino Acids Metabolism - glutathione

Chromosomal Location of Human Ortholog: 7p15-p14

Cellular Component: cytosol

Molecular Function: gamma-glutamylcyclotransferase activity; protein homodimerization activity

Biological Process: glutathione biosynthetic process; release of cytochrome c from mitochondria

Research Articles on GGCT

Similar Products

Product Notes

The GGCT ggct (Catalog #AAA1275569) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaact cgggctgcaa ggacgtcacg ggtccagatg aggagagttt tctgtacttt gcctacggca gcaacctgct gacagagagg atccacctcc gaaacccctc ggcggcgttc ttctgtgtgg cccgcctgca ggattttaag cttgactttg gcaattccca aggcaaaaca agtcaaactt ggcatggagg gatagccacc atttttcaga gtcctggcga tgaagtgtgg ggagtagtat ggaaaatgaa caaaagcaat ttaaattctc tggatgagca agaaggggtt aaaagtggaa tgtatgttgt aatagaagtt aaagttgcaa ctcaagaagg aaaagaaata acctgtcgaa gttatctgat gacaaattac gaaagtgctc ccccatcccc acagtataaa aagattattt gcatgggtgc aaaagaaaat ggtttgccgc tggagtatca agagaagtta aaagcaatag aaccaaatga ctatacagga aaggtctcag aagaaattga agacatcatc aaaaaggggg aaacacaaac tctttag. It is sometimes possible for the material contained within the vial of "GGCT, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.