Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

HSD17B6 cdna clone

HSD17B6 cDNA Clone

Gene Names
HSD17B6; HSE; RODH; SDR9C6
Synonyms
HSD17B6; HSD17B6 cDNA Clone; HSD17B6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtggctctacctggcggccttcgtgggcctgtactaccttctgcactggtaccgggagaggcaggtggtgagccacctccaagacaagtatgtctttatcacgggctgtgactcgggctttgggaacctgctggccagacagctggatgcacgaggcttgagagtgctggctgcgtgtctgacggagaagggggccgagcagctgaggggccagacgtctgacaggctggagacggtgaccctggatgttaccaagatggagagcatcgctgcagctactcagtgggtgaaggagcatgtgggggacagaggactctggggactggtgaacaatgcaggcattcttacaccaattaccttatgtgagtggctgaacactgaggactctatgaatatgctcaaagtgaacctcattggtgtgatccaggtgaccttgagcatgcttcctttggtgaggagagcacggggaagaattgtcaatgtctccagcattctgggaagagttgctttctttgtaggaggctactgtgtctccaagtatggagtggaagccttttcagatattctgaggcgtgagattcaacattttggggtgaaaatcagcatagttgaacctggctacttcagaacgggaatgacaaacatgacacagtccttagagcgaatgaagcaaagttggaaagaagcccccaagcatattaaggagacctatggacagcagtattttgatgccctttacaatatcatgaaggaagggctgttgaattgtagcacaaacctgaacctggtcactgactgcatggaacatgctctgacatcggtgcatccgcgaactcgatattcagctggctgggatgctaaatttttcttcatccctctatcttatttacctacatcactggcagactacattttgactagatcttggcccaaaccagcccaggcagtctaa
Sequence Length
954
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,966 Da
NCBI Official Full Name
Homo sapiens hydroxysteroid (17-beta) dehydrogenase 6 homolog (mouse), mRNA
NCBI Official Synonym Full Names
hydroxysteroid 17-beta dehydrogenase 6
NCBI Official Symbol
HSD17B6
NCBI Official Synonym Symbols
HSE; RODH; SDR9C6
NCBI Protein Information
17-beta-hydroxysteroid dehydrogenase type 6
UniProt Protein Name
17-beta-hydroxysteroid dehydrogenase type 6
UniProt Gene Name
HSD17B6
UniProt Synonym Gene Names
RODH; SDR9C6; 17-beta-HSD 6; 17-beta-HSD6; 3-alpha->beta-HSE
UniProt Entry Name
H17B6_HUMAN

NCBI Description

The protein encoded by this gene has both oxidoreductase and epimerase activities and is involved in androgen catabolism. The oxidoreductase activity can convert 3 alpha-adiol to dihydrotestosterone, while the epimerase activity can convert androsterone to epi-androsterone. Both reactions use NAD+ as the preferred cofactor. This gene is a member of the retinol dehydrogenase family. [provided by RefSeq, Aug 2013]

Uniprot Description

HSD17B6: NAD-dependent oxidoreductase with broad substrate specificity that shows both oxidative and reductive activity (in vitro). Has 17-beta-hydroxysteroid dehydrogenase activity towards various steroids (in vitro). Converts 5-alpha-androstan-3- alpha,17-beta-diol to androsterone and estradiol to estrone (in vitro). Has 3-alpha-hydroxysteroid dehydrogenase activity towards androsterone (in vitro). Has retinol dehydrogenase activity towards all-trans-retinol (in vitro). Can convert androsterone to epi-androsterone. Androsterone is first oxidized to 5-alpha- androstane-3,17-dione and then reduced to epi-andosterone. Can act on both C-19 and C-21 3-alpha-hydroxysteroids. Belongs to the short-chain dehydrogenases/reductases (SDR) family.

Protein type: Oxidoreductase; EC 1.1.1.62; EC 1.1.1.105; EC 1.1.1.239

Chromosomal Location of Human Ortholog: 12q13

Molecular Function: catalytic activity; electron carrier activity

Biological Process: androgen catabolic process

Research Articles on HSD17B6

Similar Products

Product Notes

The HSD17B6 hsd17b6 (Catalog #AAA1275567) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtggctct acctggcggc cttcgtgggc ctgtactacc ttctgcactg gtaccgggag aggcaggtgg tgagccacct ccaagacaag tatgtcttta tcacgggctg tgactcgggc tttgggaacc tgctggccag acagctggat gcacgaggct tgagagtgct ggctgcgtgt ctgacggaga agggggccga gcagctgagg ggccagacgt ctgacaggct ggagacggtg accctggatg ttaccaagat ggagagcatc gctgcagcta ctcagtgggt gaaggagcat gtgggggaca gaggactctg gggactggtg aacaatgcag gcattcttac accaattacc ttatgtgagt ggctgaacac tgaggactct atgaatatgc tcaaagtgaa cctcattggt gtgatccagg tgaccttgag catgcttcct ttggtgagga gagcacgggg aagaattgtc aatgtctcca gcattctggg aagagttgct ttctttgtag gaggctactg tgtctccaag tatggagtgg aagccttttc agatattctg aggcgtgaga ttcaacattt tggggtgaaa atcagcatag ttgaacctgg ctacttcaga acgggaatga caaacatgac acagtcctta gagcgaatga agcaaagttg gaaagaagcc cccaagcata ttaaggagac ctatggacag cagtattttg atgcccttta caatatcatg aaggaagggc tgttgaattg tagcacaaac ctgaacctgg tcactgactg catggaacat gctctgacat cggtgcatcc gcgaactcga tattcagctg gctgggatgc taaatttttc ttcatccctc tatcttattt acctacatca ctggcagact acattttgac tagatcttgg cccaaaccag cccaggcagt ctaa. It is sometimes possible for the material contained within the vial of "HSD17B6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.