Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DUS2L cdna clone

DUS2L cDNA Clone

Gene Names
DUS2; SMM1; DUS2L; URLC8
Synonyms
DUS2L; DUS2L cDNA Clone; DUS2L cdna clone
Ordering
For Research Use Only!
Sequence
atgattttgaatagcctctctctgtgttaccataataagctaatcctggccccaatggttcgggtagggactcttccaatgaggctgctggccctggattatggagcggacattgtttactgtgaggagctgatcgacctcaagatgattcagtgcaagagagttgttaatgaggtgctcagcacagtggactttgtcgcccctgatgatcgagttgtcttccgcacctgtgaaagagagcagaacagggtggtcttccagatggggacttcagacgcagagcgagcccttgctgtggccaggcttgtagaaaatgatgtggctggtattgatgtcaacatgggctgtccaaaacaatattccaccaagggaggaatgggagctgccctgctgtcagaccctgacaagattgagaagatcctcagcactcttgttaaagggacacgcagacctgtgacctgcaagattcgcatcctgccatcgctagaagataccctgagccttgtgaagcggatagagaggactggcattgctgccatcgcagttcatgggaggaagcgggaggagcgacctcagcatcctgtcagctgtgaagtcatcaaagccattgctgataccctctccattcctgtcatagccaacggaggatctcatgaccacatccaacagtattcggacatagaggactttcgacaagccacggcagcctcttccgtgatggtggcccgagcagccatgtggaacccatctatcttcctcaaggagggtctgcggcccctggaggaggtcatgcagaaatacatcagatacgcggtgcagtatgacaaccactacaccaacaccaagtactgcttgtgccagatgctacgagaacagctggagtcgccccagggaaggttgctccatgctgcccagtcttcccgggaaatttgtgaggcctttggccttggtgccttctatgaggagaccacacaggagctggatgcccagcaggccaggctctcagccaagacttcagagcagacaggggagccagctgaagatacctctggtgtcattaagatggctgtcaagtttgaccggagagcatacccagcccagatcacccctaagatgtgcctactagagtggtgccggagggagaagttggcacagcctgtgtatgaaacggttcaacgccctctagatcgcctgttctcctctattgtcaccgttgctgaacaaaagtatcagtctaccttgtgggacaagtccaagaaactggcggagcaggctgcagccatcgtctgtctgcggagccagggcctccctgagggtcggctgggtgaggagagcccttccttgcacaagcgaaagagggaggctcctgaccaagaccctgggggccccagagctcaggagctagcacaacctggggatctgtgcaagaagccctttgtggccttgggaagtggtgaagaaagccccctggaaggctggtga
Sequence Length
1482
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
55,050 Da
NCBI Official Full Name
Homo sapiens dihydrouridine synthase 2-like, SMM1 homolog (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
dihydrouridine synthase 2
NCBI Official Symbol
DUS2
NCBI Official Synonym Symbols
SMM1; DUS2L; URLC8
NCBI Protein Information
tRNA-dihydrouridine(20) synthase [NAD(P)+]-like
UniProt Protein Name
tRNA-dihydrouridine(20) synthase [NAD(P)+]-like
UniProt Gene Name
DUS2
UniProt Synonym Gene Names
DUS2L; URLC8; hDUS2
UniProt Entry Name
DUS2L_HUMAN

NCBI Description

This gene encodes a cytoplasmic protein that catalyzes the conversion of uridine residues to dihydrouridine in the D-loop of tRNA. The resulting modified bases confer enhanced regional flexibility to tRNA. The encoded protein may increase the rate of translation by inhibiting an interferon-induced protein kinase. This gene has been implicated in pulmonary carcinogenesis. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Nov 2012]

Uniprot Description

DUS2L: Dihydrouridine synthase. Catalyzes the synthesis of dihydrouridine, a modified base found in the D-loop of most tRNAs. Belongs to the dus family. Dus2 subfamily.

Protein type: EC 1.3.1.-; Oxidoreductase; EC 1.-.-.-; RNA-binding

Chromosomal Location of Human Ortholog: 16q22.1

Cellular Component: cytoplasm; cytosol

Molecular Function: double-stranded RNA binding; protein binding; protein kinase inhibitor activity; tRNA dihydrouridine synthase activity

Research Articles on DUS2L

Similar Products

Product Notes

The DUS2L dus2 (Catalog #AAA1275443) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgattttga atagcctctc tctgtgttac cataataagc taatcctggc cccaatggtt cgggtaggga ctcttccaat gaggctgctg gccctggatt atggagcgga cattgtttac tgtgaggagc tgatcgacct caagatgatt cagtgcaaga gagttgttaa tgaggtgctc agcacagtgg actttgtcgc ccctgatgat cgagttgtct tccgcacctg tgaaagagag cagaacaggg tggtcttcca gatggggact tcagacgcag agcgagccct tgctgtggcc aggcttgtag aaaatgatgt ggctggtatt gatgtcaaca tgggctgtcc aaaacaatat tccaccaagg gaggaatggg agctgccctg ctgtcagacc ctgacaagat tgagaagatc ctcagcactc ttgttaaagg gacacgcaga cctgtgacct gcaagattcg catcctgcca tcgctagaag ataccctgag ccttgtgaag cggatagaga ggactggcat tgctgccatc gcagttcatg ggaggaagcg ggaggagcga cctcagcatc ctgtcagctg tgaagtcatc aaagccattg ctgataccct ctccattcct gtcatagcca acggaggatc tcatgaccac atccaacagt attcggacat agaggacttt cgacaagcca cggcagcctc ttccgtgatg gtggcccgag cagccatgtg gaacccatct atcttcctca aggagggtct gcggcccctg gaggaggtca tgcagaaata catcagatac gcggtgcagt atgacaacca ctacaccaac accaagtact gcttgtgcca gatgctacga gaacagctgg agtcgcccca gggaaggttg ctccatgctg cccagtcttc ccgggaaatt tgtgaggcct ttggccttgg tgccttctat gaggagacca cacaggagct ggatgcccag caggccaggc tctcagccaa gacttcagag cagacagggg agccagctga agatacctct ggtgtcatta agatggctgt caagtttgac cggagagcat acccagccca gatcacccct aagatgtgcc tactagagtg gtgccggagg gagaagttgg cacagcctgt gtatgaaacg gttcaacgcc ctctagatcg cctgttctcc tctattgtca ccgttgctga acaaaagtat cagtctacct tgtgggacaa gtccaagaaa ctggcggagc aggctgcagc catcgtctgt ctgcggagcc agggcctccc tgagggtcgg ctgggtgagg agagcccttc cttgcacaag cgaaagaggg aggctcctga ccaagaccct gggggcccca gagctcagga gctagcacaa cctggggatc tgtgcaagaa gccctttgtg gccttgggaa gtggtgaaga aagccccctg gaaggctggt ga. It is sometimes possible for the material contained within the vial of "DUS2L, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.