Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASSF8 cdna clone

RASSF8 cDNA Clone

Gene Names
RASSF8; HOJ1; C12orf2
Synonyms
RASSF8; RASSF8 cDNA Clone; RASSF8 cdna clone
Ordering
For Research Use Only!
Sequence
atggaacttaaagtatgggtggatggagttcagaggattgtttgtggagtcactgaagtcacaacttgccaggaggttgtcatagccttagctcaagcaataggtcgaactggaaggtacacccttatagagaaatggagagatactgaaagacacttagcacctcatgaaaatcctatcatatccttaaacaaatgggggcagtatgctagtgatgtgcagctcattctacgacgaactgggccgtctctcagtgagcgacccacttcagacagtgtggctcgaattcctgaaagaactttatacaggcagagtctgccccccttagctaaactgaggcctcagattgacaaatcaatcaaaaggagggaaccgaaaaggaaatcactgacatttacaggaggtgccaaaggattaatggacatttttggaaaaggtaaagaaactgagtttaagcaaaaggtgctgaataactgcaaaacaacagcagatgagttgaagaagctaatccgtctgcagacagagaagcttcaatccattgagaaacagctggaatctaatgaaatagaaataagattttgggagcaaaagtataattccaaccttgaagaggaaattgtccgtctagagcaaaagatcaaaagaaacgatgtagaaattgaggaggaagaattctgggaaaatgaattacagattgaacaggaaaatgaaaaacagctgaaggatcaacttcaagaaataagacagaaaataacagaatgtgaaaacaaattaaaggactatttggcacagatccggactatggaaagtggtcttgaagcagaaaaattgcaacgggaagttcaagaggcacaggtcaatgaggaagaggttaaaggaaagatcggtaaggtcaaaggggagattgacattcaaggccagcagagtctgaggttggaaaatggcatcaaagctgtggaaagatctcttggacaagccaccaaacgcttacaggacaaagaacaggaactggagcagttgactaaggagttgcggcaagtcaatctccagcagttcatccagcagacagggacaaaagttaccgttttgccagcggagcccattgaaatagaggcctcacatgcagacattgaaagggggatcatcattctttctgataagcaggagtgtaaagattag
Sequence Length
1179
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,446 Da
NCBI Official Full Name
Homo sapiens Ras association (RalGDS/AF-6) domain family (N-terminal) member 8, mRNA
NCBI Official Synonym Full Names
Ras association domain family member 8
NCBI Official Symbol
RASSF8
NCBI Official Synonym Symbols
HOJ1; C12orf2
NCBI Protein Information
ras association domain-containing protein 8
UniProt Protein Name
Ras association domain-containing protein 8
UniProt Gene Name
RASSF8
UniProt Synonym Gene Names
C12orf2
UniProt Entry Name
RASF8_HUMAN

NCBI Description

This gene encodes a member of the Ras-assocation domain family (RASSF) of tumor suppressor proteins. This gene is essential for maintaining adherens junction function in epithelial cells and has a role in epithelial cell migration. It is a lung tumor suppressor gene candidate. A chromosomal translocation t(12;22)(p11.2;q13.3) leading to the fusion of this gene and the FBLN1 gene is found in a complex type of synpolydactyly. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]

Uniprot Description

RASSF8: A chromosomal aberration involving RASSF8 is found in a complex type of synpolydactyly referred to as 3/3-prime/4 synpolydactyly associated with metacarpal and metatarsal synostoses. Reciprocal translocation t(12;22)(p11.2;q13.3) with C12orf2. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 12p12.3

Research Articles on RASSF8

Similar Products

Product Notes

The RASSF8 rassf8 (Catalog #AAA1275400) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaactta aagtatgggt ggatggagtt cagaggattg tttgtggagt cactgaagtc acaacttgcc aggaggttgt catagcctta gctcaagcaa taggtcgaac tggaaggtac acccttatag agaaatggag agatactgaa agacacttag cacctcatga aaatcctatc atatccttaa acaaatgggg gcagtatgct agtgatgtgc agctcattct acgacgaact gggccgtctc tcagtgagcg acccacttca gacagtgtgg ctcgaattcc tgaaagaact ttatacaggc agagtctgcc ccccttagct aaactgaggc ctcagattga caaatcaatc aaaaggaggg aaccgaaaag gaaatcactg acatttacag gaggtgccaa aggattaatg gacatttttg gaaaaggtaa agaaactgag tttaagcaaa aggtgctgaa taactgcaaa acaacagcag atgagttgaa gaagctaatc cgtctgcaga cagagaagct tcaatccatt gagaaacagc tggaatctaa tgaaatagaa ataagatttt gggagcaaaa gtataattcc aaccttgaag aggaaattgt ccgtctagag caaaagatca aaagaaacga tgtagaaatt gaggaggaag aattctggga aaatgaatta cagattgaac aggaaaatga aaaacagctg aaggatcaac ttcaagaaat aagacagaaa ataacagaat gtgaaaacaa attaaaggac tatttggcac agatccggac tatggaaagt ggtcttgaag cagaaaaatt gcaacgggaa gttcaagagg cacaggtcaa tgaggaagag gttaaaggaa agatcggtaa ggtcaaaggg gagattgaca ttcaaggcca gcagagtctg aggttggaaa atggcatcaa agctgtggaa agatctcttg gacaagccac caaacgctta caggacaaag aacaggaact ggagcagttg actaaggagt tgcggcaagt caatctccag cagttcatcc agcagacagg gacaaaagtt accgttttgc cagcggagcc cattgaaata gaggcctcac atgcagacat tgaaaggggg atcatcattc tttctgataa gcaggagtgt aaagattag. It is sometimes possible for the material contained within the vial of "RASSF8, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.