SYDE1 cdna clone
SYDE1 cDNA Clone
Gene Names
SYDE1; 7h3; SYD1
Synonyms
SYDE1; SYDE1 cDNA Clone; SYDE1 cdna clone
Sequence
atggccgagccgctactcaggaaaaccttctcccgcctgcggggccgggagaaacttccccggaaaaagtcggacgccaaggagcgcgggcctggggtacctggcactggggagcccgccggcgagatctggtacaaccccatccctgaggaagaccccagacctccagcacctgagcccccggggccacagcctggctcagctgagtcagagggcctggccccccaaggtgcagcccccgccagccccccaaccaaagcctcccgcaccaagtccccgggccccgccaggcgcctctccataaagatgaagaagctgccggaactgcggcgccgcctgagcctgcgaggcccccgggctggcagggagcgcgagagggctgcccctgcgggctccgtcatcagccgctaccacctggacagcagcgtggggggccccgggccggcagcagggcctgggggcacccggagcccgagggccggttacctcagcgacggggactcaccggagcgcccagctgggcccccatcacccacctccttccggccctacgaggtgggtcccgcagcccgggcacccccggccgcactctggggccgcctcagcctgcacctgtacggtctcggggggctgcggccagcgccgggggccacccccagggacctctgctgcctactgcaagtggatggggaggccagggcccgaacagggccactgcgaggggggccggacttcctgcggctggaccacaccttccacctggagctggaggccgccaggctcctgcgcgccctggtgcttgcgtgggaccctggcgtgagaaggcaccggccctgtgcccagggcaccgtgctgctgcccacggtcttccgagggtgccaggcccaacagctggccgtgcgcctggagcctcaggggctgctgtatgccaagctgaccctgtcggagcagcaggaagcccctgccacagctgagccccgcgtctttgggctgcccctgccactgctggtggagcgggagcggccccccggccaggtgcccctcatcatccagaagtgcgttgggcagatcgagcgccgagggctgcgggtagtgggactgtaccgtctttgtggctcagcggcagtgaagaaagagcttcgggatgcctttgagcgggacagtgcagcggtctgcctatctgaggacctgtaccccgatatcaatgtcatcactggcatcctcaaggattatcttcgagagttgcccaccccactcatcacccagcccctgtataaggtggtactggaggccatggcccgggaccccccaaacagagttccccccaccactgagggcacccgagggctcctcagctgcctgccagatgtggaaagggccacgctgacgcttctcctggaccacctgcgcctcgtctcctccttccatgcctacaaccgcatgaccccacagaacttggccgtgtgcttcgggcctgtgctgctgccggcacgccaggcgcccacaaggcctcgtgcccgcagctccggcccaggccttgccagtgcagtggacttcaagcaccacatcgaggtgctgcactacctgctgcagtcttggccagatccccgcctgccccgacaatctccagatgtcgcgccttacttgcgacccaaacgacagccacctctgcacctgccgctggcagaccccgaagtggtgactcggccccgcggtcgaggaggccccgaaagccccccgagcaaccgctacgccggcgactggagcgtttgcgggcgggacttcctgccctgtgggcgggatttcctgtccgggccagactacgaccacgtgacgggcagtgacagcgaggacgaggacgaggaggtcggcgagccgagggtcaccggtgacttcgaagacgacttcgatgcgcccttcaacccgcacctgaatctcaaagacttcgacgccctcatcctggatctggagagagagctctccaagcaaatcaacgtgtgcctctga
Sequence Length
2007
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
72,911 Da
NCBI Official Full Name
Homo sapiens synapse defective 1, Rho GTPase, homolog 1 (C. elegans), mRNA
NCBI Official Synonym Full Names
synapse defective Rho GTPase homolog 1
NCBI Official Symbol
SYDE1
NCBI Official Synonym Symbols
7h3; SYD1
NCBI Protein Information
rho GTPase-activating protein SYDE1
UniProt Protein Name
Rho GTPase-activating protein SYDE1
Protein Family
UniProt Gene Name
SYDE1
UniProt Synonym Gene Names
Protein syd-1 homolog 1
UniProt Entry Name
SYDE1_HUMAN
Uniprot Description
SYDE1: GTPase activator for the Rho-type GTPases by converting them to an inactive GDP-bound state. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: GAPs; GAPs, Rac/Rho
Chromosomal Location of Human Ortholog: 19p13.12
Cellular Component: cytoplasm; cytosol
Molecular Function: GTPase activator activity
Biological Process: regulation of GTPase activity; regulation of small GTPase mediated signal transduction
Similar Products
Product Notes
The SYDE1 syde1 (Catalog #AAA1275389) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccgagc cgctactcag gaaaaccttc tcccgcctgc ggggccggga gaaacttccc cggaaaaagt cggacgccaa ggagcgcggg cctggggtac ctggcactgg ggagcccgcc ggcgagatct ggtacaaccc catccctgag gaagacccca gacctccagc acctgagccc ccggggccac agcctggctc agctgagtca gagggcctgg ccccccaagg tgcagccccc gccagccccc caaccaaagc ctcccgcacc aagtccccgg gccccgccag gcgcctctcc ataaagatga agaagctgcc ggaactgcgg cgccgcctga gcctgcgagg cccccgggct ggcagggagc gcgagagggc tgcccctgcg ggctccgtca tcagccgcta ccacctggac agcagcgtgg ggggccccgg gccggcagca gggcctgggg gcacccggag cccgagggcc ggttacctca gcgacgggga ctcaccggag cgcccagctg ggcccccatc acccacctcc ttccggccct acgaggtggg tcccgcagcc cgggcacccc cggccgcact ctggggccgc ctcagcctgc acctgtacgg tctcgggggg ctgcggccag cgccgggggc cacccccagg gacctctgct gcctactgca agtggatggg gaggccaggg cccgaacagg gccactgcga ggggggccgg acttcctgcg gctggaccac accttccacc tggagctgga ggccgccagg ctcctgcgcg ccctggtgct tgcgtgggac cctggcgtga gaaggcaccg gccctgtgcc cagggcaccg tgctgctgcc cacggtcttc cgagggtgcc aggcccaaca gctggccgtg cgcctggagc ctcaggggct gctgtatgcc aagctgaccc tgtcggagca gcaggaagcc cctgccacag ctgagccccg cgtctttggg ctgcccctgc cactgctggt ggagcgggag cggccccccg gccaggtgcc cctcatcatc cagaagtgcg ttgggcagat cgagcgccga gggctgcggg tagtgggact gtaccgtctt tgtggctcag cggcagtgaa gaaagagctt cgggatgcct ttgagcggga cagtgcagcg gtctgcctat ctgaggacct gtaccccgat atcaatgtca tcactggcat cctcaaggat tatcttcgag agttgcccac cccactcatc acccagcccc tgtataaggt ggtactggag gccatggccc gggacccccc aaacagagtt ccccccacca ctgagggcac ccgagggctc ctcagctgcc tgccagatgt ggaaagggcc acgctgacgc ttctcctgga ccacctgcgc ctcgtctcct ccttccatgc ctacaaccgc atgaccccac agaacttggc cgtgtgcttc gggcctgtgc tgctgccggc acgccaggcg cccacaaggc ctcgtgcccg cagctccggc ccaggccttg ccagtgcagt ggacttcaag caccacatcg aggtgctgca ctacctgctg cagtcttggc cagatccccg cctgccccga caatctccag atgtcgcgcc ttacttgcga cccaaacgac agccacctct gcacctgccg ctggcagacc ccgaagtggt gactcggccc cgcggtcgag gaggccccga aagccccccg agcaaccgct acgccggcga ctggagcgtt tgcgggcggg acttcctgcc ctgtgggcgg gatttcctgt ccgggccaga ctacgaccac gtgacgggca gtgacagcga ggacgaggac gaggaggtcg gcgagccgag ggtcaccggt gacttcgaag acgacttcga tgcgcccttc aacccgcacc tgaatctcaa agacttcgac gccctcatcc tggatctgga gagagagctc tccaagcaaa tcaacgtgtg cctctga. It is sometimes possible for the material contained within the vial of "SYDE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
