Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MEPCE cdna clone

MEPCE cDNA Clone

Gene Names
MEPCE; BCDIN3
Synonyms
MEPCE; MEPCE cDNA Clone; MEPCE cdna clone
Ordering
For Research Use Only!
Sequence
atggtgggcctggatatcgattcccggctcatccattctgcccgccaaaacatccgacactacctttccgaggagctgcgtctcccaccccagactttggaaggggacccgggggcagagggtgaggaagggaccaccaccgttcgaaagaggagctgcttcccagcctcgctgactgccagccggggtcccatcgctgccccccaagtgcccttggatggagcggacacatcagtcttccccaacaatgttgtcttcgtcacgggtaattatgtgctggatcgagatgacctggtggaggcccaaacacctgagtatgatgtggtgctctgcctcagcctcaccaagtgggtgcatctgaactggggagacgagggcctgaagcgcatgtttcgccggatctaccggcacctacgccctgggggcatcctggtcctagagccccaaccctggtcgtcgtatggcaagagaaagactcttacagaaacgatctacaagaactactaccgaatccaattgaagccagagcagttcagttcctacctgacatccccagacgtgggcttctccagctatgagcttgtggccacaccccacaacacctctaaaggcttccagcgtcctgtgtacctgttccacaaggcccgatcccccagccactaa
Sequence Length
663
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,950 Da
NCBI Official Full Name
Homo sapiens methylphosphate capping enzyme, mRNA
NCBI Official Synonym Full Names
methylphosphate capping enzyme
NCBI Official Symbol
MEPCE
NCBI Official Synonym Symbols
BCDIN3
NCBI Protein Information
7SK snRNA methylphosphate capping enzyme
UniProt Protein Name
7SK snRNA methylphosphate capping enzyme
UniProt Gene Name
MEPCE
UniProt Synonym Gene Names
BCDIN3; MePCE; Bin3 homolog
UniProt Entry Name
MEPCE_HUMAN

Uniprot Description

BCDIN3: a CDK9-associated enzyme that forms the distinctive gamma-methylphosphate cap structure of 7SK, a noncoding RNA that regulates CDK9 activity. An adenosyl-L-methionine-dependent methyltransferase that adds a methylphosphate cap at the 5'-end of 7SK snRNA, leading to its stabilization. Component of the 7SK snRNP complex that contains P-TEFb (composed of CDK9 and CCNT1), HEXIM1, HEXIM2, BCDIN3, SART3 proteins and 7SK and U6 snRNAs. Expressed in chronic myeloid leukemia cells, adrenal gland, brain, cerebellum, kidney, lung, mammary gland and testis. Weakly or not expressed in other tissues. Contains a Bin3 domain found in a number of protein methyltransferases that modify RNA-binding proteins.

Protein type: EC 2.1.1.-; EC 2.1.1.; RNA processing; Transcription regulation; Methyltransferase

Chromosomal Location of Human Ortholog: 7q22.1

Molecular Function: RNA methyltransferase activity; S-adenosylmethionine-dependent methyltransferase activity

Biological Process: RNA methylation; snRNA metabolic process; snRNA modification

Research Articles on MEPCE

Similar Products

Product Notes

The MEPCE mepce (Catalog #AAA1275338) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgggcc tggatatcga ttcccggctc atccattctg cccgccaaaa catccgacac tacctttccg aggagctgcg tctcccaccc cagactttgg aaggggaccc gggggcagag ggtgaggaag ggaccaccac cgttcgaaag aggagctgct tcccagcctc gctgactgcc agccggggtc ccatcgctgc cccccaagtg cccttggatg gagcggacac atcagtcttc cccaacaatg ttgtcttcgt cacgggtaat tatgtgctgg atcgagatga cctggtggag gcccaaacac ctgagtatga tgtggtgctc tgcctcagcc tcaccaagtg ggtgcatctg aactggggag acgagggcct gaagcgcatg tttcgccgga tctaccggca cctacgccct gggggcatcc tggtcctaga gccccaaccc tggtcgtcgt atggcaagag aaagactctt acagaaacga tctacaagaa ctactaccga atccaattga agccagagca gttcagttcc tacctgacat ccccagacgt gggcttctcc agctatgagc ttgtggccac accccacaac acctctaaag gcttccagcg tcctgtgtac ctgttccaca aggcccgatc ccccagccac taa. It is sometimes possible for the material contained within the vial of "MEPCE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.